Description :
From Genome Similarity Track
Location :
Scaffold_874:3647- 5997
Transcript NameFunction/comments
Phypl_g11395phospholipase D, Pi-PLD-like-1

Sequence
2350 bases(100 bases per row)
GGAACACCGAAGATCGCACTTCAAAGCCAACTTCAAAATCTTCAACGTGCATTCCAAACTTTTTATTCAATTTTGATTCACTCTTCACGTTCTTGATGAA
CATAGTAACCCAGCTATCATTTCACACCAGAGAGAGAAAACAAGCTCAAAGAGCGAAAAGGCTATACAGACACATCATCCACATCAGCACAGGCTGGAAA
CGCTTAGTTGTCGTCTTCCTCAACATCCGggtccacgagctggcgcagagCATCCGGCACAAAGTCGAAGGCCGcgttgtccacgacgccgtaTGGCTCG
ATGAGGCTGGCGCCGTTGTCGTgagccgccgcctcgagcgcgtcgcaCGCCTCCAGGAACGtcatggcgtccagctcgtcgtacgTCAGCTTCGTGGCCT
CCATGAACTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGCgactgcaccagctccgtgtCCACAATGTTGACGCCGATCTC
CGTGTCGCTCGTCATGCTGCGGCGGTTCCAGTTGGCCGAGCCCAGCGACACGTACACGTCATCCACGATCACCAGCTTGCTGTGGATGTAGAGCTGCTTG
GATTCCTTGGTCGAGTACAGCTTGAACTTGTCCGGGTACGCCTTCTGGATTGGGGCCACCATGTCGTACAGGTACTTGGCGTAACCCGTGTAGCCGGCCT
CAACCgtgcgctgcacgacgacaATGAGGCGCTCGATGCTGGGCATCATCTCCATGATGGCCTCCAGTAGCTCCGGCACCAGGATGAAATACTGGTCCTG
GATGAAGATGTAGTTCTGCGCGTTGCGGATGGCCTTGATGCGCGCGTGGAAGATGGACTGCTCGCCCTGCGGCGCGAAGCCGTAGTGGTCGTAGTCCGGG
CTGAAGGTGCGGCACAGCTGCACAGCGTGCGTGCCGTCCGTCGGGATGTCGAGCGGGGTCTCGCTCTGGTCAATAGGGGGAAGCTTGGAGTAGTCGGGGT
TCTCAAAgtccagcaggtcgtccatGAGGTCctgcgacggcttcgtgtCCGAGTTCCAGCGGTCGAAGAAGTTCTGCGCCACGTCCTTGGTGGCAGGGCC
CTCGATACGTGCGTGGGCATCCAGCCAGCCGTCCCACAGGCACTTGATGCCCGTGCGCTCACGGAGCGCGGCCTGGTCGTGCTCAATCGTGTCCCAACGA
TCATTGGTAAGGTCGACGCCGCCCACGTAGGCGACGAGGTCGCGGCCCTTGCGCACGATCACCGACTTCTGGTGGTGCGACGACGTGGCATGCGGCAGGC
GGTCGTCGTACACGAAGCGGGCGGGGCCGTTCTGCTCcggaggcggcagcgcgtTGACGAGGTCGCGCACCTCATGGTTCTGAGCGCGCTCCGTGATGTT
GGACCACACGAGCATGCGCCAGTCGGCTCCGCGCTTGACGGCGTGCTCGGCCAGGTCGCACAGCTTGGTGTCGGGCTCGTGCGGCTTGAAGGGTACGTTG
CAGGTCCCCCAGCCGGTGAGGTAGACCAGGTCTCCGCGACGCACGTCCAGcatgtcgtcggccacgtcgctgAAGTAGCCGGCCGAGGCCACGTAGAGCT
TGACGCGGTTGCCCTTGGTGAAGTTCTGGATGCCCTCGCGCTTGTAGCCGTCACGCGACGTGCTCATCTCGTCCTCGGTCAGGAACCAGCGCGAGGGCTC
GAGGTAGGGCTGGTCGAAGGGCGCGGTGGACGCcttctcgggcttcttctcggcctggAAGGGGTCGACGATGAAGTGGAAGGCGCGGCTGAGTCCGTCC
ATGGTGAGAGGGGAAAGCGAGGGAGCGAGGggggcttgagctcgagcgcgcaGAAGCTGGAATGAGCAGCTACGAGGGATGGCTCTCTCTTTTATATAGG
CGACTTTGTATGGGGTGCCACATGCGTGGAAATCAGTTGGATCGCGCTTCCGCCAATgagcggcgcgcgcgctccatGTGGGTTCAGAGCTGGCTCACAC
GACTTGGAGCGCCGTACACAACGTCACCTGGCAACGGTATAGCGGGACAGTTTGCTGCGGTTGCGTGCCGTTTGATCTCGGTGGCGATGGCATGACCATA
TTGCTGCGGAGGGAGGCGCTTATTccgctggcggcgtcgacggcagcagacgctgcgaTACCCGAGCGCTGGATCTTGAGGAGCATAGGGAACAAGGTAC
AAATAATATGATACTACAAACTAGGACGGTCTTGACACGGAGGATTGCAGGGCTCTCGGCGGCATTGATCGCCTGCATGCGTTGCTCTCACCGGTCTATG
CGCGTAAATCCCTGTCGACGAACGGGTGAATTGAGCGCTTTCTTGCTTGA