Description :
From Genome Similarity Track
Location :
Scaffold_248:3647- 4822
Transcript NameFunction/comments
g8527.t1POM76437.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
1175 bases(100 bases per row)
GTCCAAAATCTTTTCAACTTCGTACTCGTCCCTTTCAGAGTCGGGTTCCCAACTATCTTCCGGAAGTAGTGCAGCATCAAAGTCGCCATCTTCATTCACA
TTCACCTCCATATTCGGGCGTTTTGGAAACAGAGCTCGGGGTTTCAAACGACTGATGTGCACCCAAGGGTTGACGCGATATCCGGTATCGTCGATCTTGA
GCTTCACCCTGAAGTCATCATGCACAGCTTCAATCCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAATCCAGGTTGGACCTTCGGAATGTA
CAACCACACCAGGTCACCCACTTCGAACCCGGACTTCAGTCGGTCGGAAAGTTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTC
TTCTGAAGATCTTCTGCACATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAGCGGTCCTCTCCTGAAGACTTGATGGCTTCG
GACCCAACATTGCAGATAACGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAA
CATGAGTCTTTCTGAATGATCGTCCCAATCACTCTGATCCGCTTCCGAAATGTACGCACGGATGCTCCTGACTACCGTCTGGACGGACCGCTCCTGTTGG
CCATTTGCCTGGGGACGATATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAACGGGTGAACACCTCGCTCATAAACCTTGGGTCTTGAT
CGTGACGTAATATCGAACTTGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAGCTTCCGCTACATCCTGAGCTGTCGTCGAATTCATGGGTTTGCACAT
GACGAATCCGGAAAACGTATCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTCGGACTTCGGCATATGCGTCACAACGTCCATCGAGGCAACTTTGAAA
GGTCTTCTGGGTTCGATGTTTCCAGGCGACGGACCAGCATTCGGAGGTTGTCTCTTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACAT
CCGAATACATCCCCGGCCAATAAAATTCCAAACGCAATTTATCGTGCGTCTTGGTGATGCCTTGATGTCCCCCCT