Description :
From Genome Similarity Track
Location :
contig_23:364643- 367009
Transcript NameFunction/comments
g5153.t1reverse transcriptase
g5154.t1hypothetical protein

Sequence
2366 bases(100 bases per row)
CGGATCCGTACTACCCCCTTTTGAAGGAGTTCTCGGATGTGGTCAGCGATAACCCACCGTCGGTGTTACGTCCGGACCGAGGTGTGCGACACGAGACCGA
TTTGGCGCCGGGCACCACATACTGCACCACGCGCCAATGGCCACTACCGAAGGAGCAAGTCGATGTGATCGACGCATTCTTCGCGGCAAAATATGCCGCG
GGCATGGTGCGCGAGTCAATGTCGCCGCACTCGTCCCCGACGTTTTGCGTGCGTAAACCCAATGGGAAGTGGCGCATGGTACATGCGTTCAACAAGTTGA
ATGCGGCAACCATCCCGACGTCCACGCCAATCCCTCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCGCTCGACATGGTCGA
TGGCTACTATTAGTTGCTGATGCGGGAATCAGACGTCCCACTCACAGCGGTGGCACACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGAGAT
TGTCGAACGCACCAACCACGTTCAATCGACTGGTGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAG
TCGTGCCTCGGGAGGTAAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGCGAGGTATTGATGTGCATGCGCGATAATCGCTTGTATGCGAACATCAAC
AAGTGTATCTTCGGAGCCGAAGAGATTCCCTTCTTGGGATGTTCCCTTGGCAAGGATGGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGTGCAAT
GGCCAGTGCCAGTATCTCAGAAGGGCTTGCGCAAGTGGCTTGGCCTTGCCAACTACTTACACAAGTACAGCGCCAACTACGCTGATATGGCACGGCCGCT
GACGAACCTCTTAAAGAAGGAGGCGGAATGGTCGTGGGACGATGAAGCTCAGCAGGCTTTCGAGGCAATCAAAAGCAGCCTGCAGAGCGCTCCGATTTGG
CTTTGCCCGACGATGATCGTCCCTTCAGTGTGGTATGCGACGTATCCGACTTTGCCATAGGCTGTGCCCTGCTGCAGGTCGATGCCGATGACAGAGAACG
GGTAGTATCTTTCCAGTCGCGCCAACTCAAGGCGGCTGAAAAGAACTACCCTGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCGCTCGTAGAGTTT
CGGGTACACCTGCTTGGCAGCAAACCCTTTGTGATCAACACAGATCATGCGTCCTTGCGGACAGCGACGTCGTCGCCCCACCCTACCAGCGGATGGCGAG
GTGGCTCTCCTTCTTTGCGGAGTATAGCTTCGCGGTGGAGTACAAACCAGGGAAGCAGAACGTCCTCGCGGACGCGTTGTCCCGGCGTCCGGACTATGAG
CTGGCGTACGTTGCGTATCTCGAGTATCCACTCTATAAGCTGCTACGCGAGGCGTACGCAGAGGATGGCGATCTCGCCGATCTCGTAACTTCACTGAAAG
TGCCTGAAAAGGCTGTGAAACTCACTGCTCGGCAGCGCTCACGGTTGCACGCTACTCACTAGCAGATGGTCTTCTACACTATCAGGTAGAAAAAGCGACG
AGCCTCGTATCGTGGTTACCAACGACGAGAACTTACGTCATCGAGTCCTCTACGAGGCACACGACACGTCGATCAGCGGTCATCTTGGCCGAGAGAAGAC
GTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATGTATAAGTGGGTGCGCACGTACGTGCAGACGTGTGAGACGTGCCAACGTGTGAAGCCCGCC
CCATCGTCGTCGGCTCCATTGATGAGCTTGTCGGTGCCGGCTGACTGTTGGCGCTCGGTGAGCATGGATTTCATCTTTGAGCTCCGGCGGACACGCGCGG
CCACACTGGCGTCTTGGTCTTCGTCTGTCGACTGAGCAAGATGGTGCGGCTTGTGCGGTAAAGAAGAGCGTGACGACGCCGCAAGCGGCACAGCTCTTCG
TCGACAATGTCTTTCGACACGATGGCCTCCCGGAGGCATTCGTGAGTGATCGAGATCCGCGCTTTGTGTCCCACTTTTGACACACTTGTTCCGACTTCTC
GGTACGAGATTGGACATGTCCACAGCGGACCATCCACAGACCGATGGTCAGACGGTGCGCGTGAACCGTGTCTTGGAAGACGTACTGCGCAGCGTCTGCG
CCGAAGAACCCACCAAGTGGAGCACGCTGCTACCCCAAGTGGAGTTTGCGCTGAATAATGCTGTGCATTCGTCGACGGGTTTCACCCCATTTATGTAAAT
GGCTTGCGGCATCCGCGAACGCCGCTATCGTTGCCACCGGCTTCGAATTTGAGTGGGGGAGAGGCT