Description :
From Genome Similarity Track
Location :
Scaffold_147:36461- 38265
Transcript NameFunction/comments
Physo_143656reverse transcriptase

Sequence
1804 bases(100 bases per row)
TTTGCAGTCACTTCAGCGGGTACTGCAGCAAGATGTACCATTGCGAAGTCGGATGCGTCACACACCACGTGGAACGGGCGATCTTGGTCGGCCACCGCCA
AGATCAGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAGGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAG
CGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGTGTCGGCCAC
TCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGAGGCACTTCT
TCAGCTTCGCATAGAGCTTGTGGTTGCGCATGAGCGCAAACAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCT
GTGGACGAACACATCGTCGAAGTAGATCGGTGCGAAGTCGCGCACCGAGCGCAAAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGCC
CTTGCGGCATCACCAGCCACTCCCAGAACATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATC
GCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTC
AGCTTGTTGTATGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCCAG
CTTTGCGACGATTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATC
AATCTCGTGCTGAATTCCCATGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGACCTCGTAGTAGGGACTCGTC
TTCAACGAGTCCCAGCTTTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCTTCGCTCTCAGTGGTGTTCTCCATGAAGAACTGCCTCA
GTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATCTGCTCGATGCGTTCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCAT
GACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCGCAGGTACGCGTCAAGACGTTCAAC
GTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGTAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCC
GTCTTCTTATCCTGCGGAGCCCGGCTCCGCAAGACTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCCGGTTTATC
CCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGAACGACAGCATGCAAGTTTTTCCGGTGCGGAATGTTTG
CAACCGTCCGCACCGCCTGCAGCGTCGACATGCTATTTTCACCTCGACGCCTGTTATTGGCGGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGC
CGAC