Description :
From Genome Similarity Track
Location :
Scaffold_91:36459- 37496
Transcript NameFunction/comments
Albla_Nc14064670deoxyhypusine hydroxylase putative

Sequence
1037 bases(100 bases per row)
TTGCTTGCTCGAAGACCAGTAGTCCATGATATCAAGCGCTACTTCACAACTCTCACGAACCACTTGGTCCTGGTCCAGTTGGAACTTTATGAGAATATCC
GCGCATTCTGCGGATCCAATAGCACCTAAAGCTTCAGCGGCTTCGTGTCGCACCATCCGATGTTCAGATTCGTCGAGTAGCAAGCGCTTGAGTGCGCTTA
CAGTCACAGGATTTTCCATCTGACCCATTACATATGCAATTTCGTGCCGAAACAATCGACTTTTATCATTCAAACCTTTTGTCAATGCCTAATCAGGGAT
AACGTTAGTTCCTTTCTCGTATGCTGAATGCAGAAGCAGCTAACCATAGCAGATTCCTGAGTTTTGCGATTGCGAAGTGAAAACATGGCACGGTATCGCT
CAAATAGCGGTCTTGACTGGTCTAAGAGTATAGATTCCAATGTTTCAATGGGAACAGACTTCTCAAAAGCGGGTGCTGGATCGACTGATAAATATGGATT
GCGATCAAGATTGGATTCATCGCATTTAGCATTCTCCTATGCATCAAAAGCATTGAGTGAATAGATCATGGATGCTACTTGATCATACCTTATTGATTTT
GTACTGAATGAGGTCAATTGCGAGGCGACACGTTTCTGATATCTCCGGATCGGAGTGATCCACAAACTTCTTTAGAGTTTGCACCGACTCTTTTTGACCG
ATCGCACCCAATGCTTCAGCTGCTTCATGGCGTACCATAGAATCGTCCGCTTCGTCCTGCAAGATTGCCTCTAGCACAGAACATGCACCACTATGCTGGA
ATTGACCGATCACATAAGCGAGTTCATGTCGCATCAGCTCGGTATCGTTCCTATTTTGCAATGCTGTTGTTGCTCATCAGTACGTTTGATAGCAATTGTG
GTTTAAAGAGAACAAGAACCTTTAAGCAGCACGTGAAGATCCTCTTGCTGTCCACGTGTACGTAGATAAAACACAGCTCGTGTTCGTTTGCCTAGAGGTT
GTGAAATATCGAGCAATGCATCCTTTAACGCTTCAAA