Description :
From Genome Similarity Track
Location :
contig_20:36458- 41553
Transcript NameFunction/comments
g4177.t1hypothetical protein
g4178.t1hypothetical protein

Sequence
5095 bases(100 bases per row)
GCGAGGGAGTCTCGGCTTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGG
ACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTC
ACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCCGATCGCGTTACCGCTGATACACGAGCTACAGCGTTA
TTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAG
CTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCG
CAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCTGTCCATAG
TGGACAGGAGATCGAAGCACAACAACAGTCCGCGATATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCC
CGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACC
GTAGGGGGTGGCAGGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGTGTGATGCTTGCTGCGAT
CGCTCCCAGAATCTCATCCTCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAG
CCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGC
CAAGACTTCCTTGTCGACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACG
AGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTT
CAGCATCGTGAATGCGATTTTCGCTCGGACCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTGTTCGCCGGGGATGGACCTGTTCT
GCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAGCGACTGTAGTAGTTCAAACTTCC
AAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGG
TGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCT
CACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGA
ATCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGTGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCA
TTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTTCGTGCGCGTTCTGTCATGGAGACTACCCAGA
AGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAAATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTCGTCAA
ACTATTCACCATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCGCCTGG
GTCATAGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTCGCGTTCTGATCGCCGGTGCCACCTTCCTGAT
CCCTTGGAGACCCCTCAGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCACGACACAGGAT
TTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACACGGTCGGTAGTAGACTGGAAAGCT
AGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGACATGGGTGTCGT
CTTGCAATACTAACTTCTGATCGCTGATATTCGTGATCTTCAGATAGCGAGTTTTCCCCAACCTGTCACCAGACTCGGTACCCATCTATCTCCTCGAGTA
ACCCACAGTTTCCGGTGGCTCGACAAGATGAAACCCTTCCGAATTCGATCGACTCTCCGACTTCCAACTGGCAATGTTCTCCGAGCTTGACCTGCGTGAC
CTTCTCTCGTAGAGTTGACGTCGGCCGGCTAGCTGAATCCGCACTTCGTCTGGAAGATTGATTGATCCATCAGCCAGATCGAGGCGAATGCCAGCTGGCA
CCATGAAGTCCATCCCCAGGATCAGGTCTTGGCCGCCTGTGGGCGGACCAACCCACGCGTCGAAGTAGTACACCAGTGATCCAGCGAGTGTGATCTTGAT
TCTGGTACGCCCATCCGCCATATAGGGATTCTTACCAACTCCTTCACATTCCAACTCTTGACTGTTGTCTATGTAGCACCCAACCTTACGAGCAAAGGCG
GCATCCAGAATGGACACCTCGGCGCCGCTGTCAAACAGCAATGTGGCTCTTCGTTGTTGATCTTCCCATGGTTTTCGCCTGCCGGAATTTCTTGTCTGGC
ACATGGTACTTCAATATCCTCGCGACTCTCCGTGCAGGAGATCCAGAGCCATCGTCACTTCTGATCGCGAATACTCGTCGACTTGGTGGAGGCTGGAGAT
CGCCATGGTACGTTTGTCATGAAGGTCACATGTATTGTCCGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTGTTTTTCGACATATGCATAGATG
CAGAACTGAGAACGCTCGTCTCGTACCGGATTCAAACCGGCGAGCGTTCTAGTTTAACATCTTTTCAGCCGCTTGCGGGAGCATTCCACCGTGCTTGGTG
GGGTTGTACCATTGACGGATCAAGTTGTAGAACTCTTCCATCGGGCACTCTCCGGCTCCGTGAATCTCGCCGCAGGCCTTGCAGACGAAGAGGCAGCGAT
CGGTCGGGTGGCCCTTCTTGCCACATTTCTCGCACGTCAGACGCTTCCAGCAACCAAGATCGGTGTGCTTCGACGATCCACAGTGGGAACATGGCTTCCG
CGGGGCTTCTCCCTCGAGAGATCCGGCTGGACGATCGAGGCGACGGTCGTTGGAGTCTCGACTAGGACGGCGTTGCTCCTGATCCGAATGCGATCTGGTC
GGCTGATCGGGCGTTGCCGCGAAGTACCCTTGCGTAGGTCTCCCTCACCCTCCGATCCGCTGGTTTCCAATTCGGAGTCGCTCGAGTTGACTGTGTGCGG
ATTGCGCGGACTGCGCGGCATTCGCGGATGGGGTGATTCCCGTGGGTGATTTCTGCTTGGGTTTGATGGACCCATACACCGTCTTTCCTTGTCTCGCCTT
CGCACGTTGTCGGGATCGCAGTGTCTCTTCGAGAGTGTCTGCGTCCGGAATTCTTAGCAGTGCCAGTTGGCTGGCTAGATCGCGATCGTCGAGTGTTTCG
ATGAAGTGATCGACATGTTCACGGCGGACCTCAATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGTGCAGATATTCCA
GCGGCGATTCATCCGATCGCTTTCGCGCATGGTAGTATTGTCTCGCGACAGACACGCCACGTCCGCAGTATTGAGTCTGGAAGTTCTTAGACAAGCTCTT
CCAGTTGCCGCGCGCGTCCGACTCAGCTGTCGGTACCAGTTACGTGCGGGTCCAGTGAGCAGATCTACAAACACCAGACACTTCGCCATCAGGAGCTTGA
ACGCGGACAAAGACAGACTTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTATCCTTCCCCGAAAATTCCTTCAGTTCTGAGATCGCGGAGA
CTCGGATCCTTGTGGCTGAGAGTGTTCCGCCGCCTGTAGTCCCAGCAGATGCGACTGCGGCACGAGGGGTAGCGTCGACACCCAGGTCATCCGGATCGTA
TTCGCTCGGGTGCGAATGGTCCCGGCGATTCGACTCCACGGACTCCATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCGACGACTGGCGTGGTC
GAGACCGCTTGCTGTTCCTTCAGGAAACGCTCCATTGCTGCATTGAAGAACGATTGCATGCGTTCAGGGGAGCTTGGGCTGGATCGCTCGTCGCGATAAC
TGTCGGCTTGGTTTCCGATCTCTCCTTTCGCGACTGTAGCATGGCTGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGATCGAGCTGTCCGATCCC
GCTTCGGATGTGGCTGAGGCATATTGCGACGATCCGGTTTGGCTGCGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACACTACCGACAAGGGGCG
TCAGCTTCGCGAACAGGCTCAGCGTTGATTCCTGATGATTGGCAATTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGAGCACGATTCCCG