Description :
From Genome Similarity Track
Location :
Scaffold_206:36455- 42486
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.22Endoribonuclease
Pytap_DAOMBR444snap_masked-pag1_scaffold_206-abinit-gene-0.34Pre-mRNA polyadenylation factor
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.2360S ribosomal protein L21-1

Sequence
6031 bases(100 bases per row)
ATGAAGGTCGTCGCGCTCGTGAGCGGCGGCAAAGACAGCTGCTACGCCATGATGGAGTGTGTGCGCAATGGCCACGAGATCGTGTGCCTCGCGCACTTGC
ATCCACCGAaGCATCTGACGCCGGATGAGCAAGAGATCGACTCGTTCATGTACCAGTCGGTGGGCCATAACGTCGTGCAGATGATTGCGCAGAGCATGGA
GCTGCCGCTCGTGGCCGAGACGATCACGGGCAAGGCCGTGACGACAGACATTGACTATACCGCCACAACTGAGGGCGACGAGGTCGAGGACTTGCATCGG
CTGCTGGAGAAAGTGCTGGTGCGAAGTGAAGAGCTAGCTGGACGAAGAGCTACGGTGGAGAGAACCTCATGCTCGGGTGCTTTGTAGGTGCAGTACCCCC
AAGTGCAGGGCGTGTGCTCGGGCGCGATCTTCTCCTCGTATCAGCGCAACCGCGTCGAGAATGTGTATGTGAAGCATGAACAGTCGGAGATACTGGAGGA
GTGTACTGACTGGGAACTGATGGGGTAGATGCTCGCGTCTCGGGCTCATTTCaCTTGGGTACTTGTGGCGACGCGATCAGGAAGAGCTGCTAGGCGATAT
GGTGGACGCTGGTATGGAGTCAATCCTGGTCAAGGTCGCTGCGATCGGCTTGAATCCTCGCAAGCATCTTGGCCGCACCATCGGCGATCTACAAATGGAG
CTCTTGAACTTGGTATGCTGTGTGTATCTACTGTCGCATTATTGATACCCCCATCACTCTCATCGGCATGTGGTCACTTACCAGCAAGATAaGTATCAGC
TGAACGTGTGCGGAGAAGGCGGAGAGTACGAGACGCTGACTCTCGACTGCCCTCTGTTCAAGATGCGTATTGTCGTGTACGTCCTCCTCACCACTGCCAT
TCCAGTGTCCGTCTCATGACTCACCAATGACCTCATGTGtAGGGATTCGTCTCGTACGGTGCTCCACTCTGACGACTACTTTGCACCCGTGGCATTCCTC
GTAATTGAGCAGTGCCACCTGGAGGACAAAGAACGGAACGAAGACGACATCGCTTTGCTGTCCAAGTCTCCGCTTCTTCGTCCCCCGTACACACCACCGA
CTACGTTCcAGAATGATGCCGTTCTTCCGAGTCCAACTAAAGCGCTTGCACTCTGTACGACCGACCGCAGCGTGGTCCCCATgaTCCGCTCGTTTCGAAA
CCAAGCCTTCCTCAGTGGTGTCATGAGCACTCGAACTGCCTCGCTGTCACTAGCCGACGAAATGCAAGACGTCTTCTCGCAGGCCATCTCAACACTGCAG
CAGCAGGGTATGAGCCTCGAAGATGTATGCTTCGTCCACCTCTACGTGCGTGATATGAACGACTTTGCCAGCATCAACACCGAaTTCTGCAAGTACTTTG
GCCAGTAtATGCCGCCTTCGCGGAGTTGCGTCGAGCTTAACACACTGTCTGCTCGTGTTCTCATGGACGCGTTTGCCATCAAGGgCAGCGGCCTGGCCAA
GCTTGAGAAGCCACGCGGTCCAATGCGCGACGTGCTCCATATCAAaaGCATCTCAGCGTGGGCGCCGAACTGCATCGGGCCATACAGCCAAGCCAACACC
cTGCACAAAGCACTGATTtGTCTTGCAGGCCAAATCTCGTTCCAGCCTCAAaCAATGGAGATCGTCGGTGACAACCACATCGCCCAGaCCcAACAGGCTa
TGCGCAACGCTGGCAGTGTACTCGACGCGCTTGACTCGAACTTGCGGCACGTGAGCAATGGAGTCGTCTACGTGACAGCCCCACTTGGTGAGAAGGGTGT
GACTGACGTGGTCGAGACGGAaTGTCGTCGGCTACTTATTGCGAACGGAAACCTGCGGGACGCTTTTAAAAaTGCGTACAACAGCGATGAAAGCGACGAC
GAGGTCGACAAGCACGAGGCGCtCGTCGGTCTCGTGACCCACGCACCTCTTCTCGTCGTGCAATTGTCACATCTTCCACGTCACGGGCTCGTGGAAGTtG
AaCTCCAGGCGCTTACTCATGGTCCTGTCAAGCACTTGAACCCCCAGTCACAGTGTTCGACGCTTGGCGACATCGACGGCTGGGCCATTCGCACCCAACA
CAGCAGTATCAAACGGTCGTTGTGTCACATTGTTTCCACGGCCAAACAGACGAGCtgTGAAGCTCCGAAACTAGAAACCGCGATCCGTGGCCTCTTGCTT
GGCGTGCAGGCAGCACTGGCTACGGCGGAGATGCCGTGGGATCGCTTGgcTCACATTCGAGTCTTCTACGTCCCGAACAACCACACTGAAAGCGagTTGG
TGATCGCGCAAGGTATGCATGCTCTTGATCAGAGTATTTTGTTtACGAATGGCTCACCATtGCGAATGTTTCTGCAGCAATCGAAGCGAATCTGCTGGAT
GGAATTGAAAGTGGAGCCCTTGTGATGCCGGCCATCACGTTTGTACCTGTCGAGGCTGTTCAGGGCGGCgCGAGTGTCGCTATTCAGGTGACTGCACAAG
ACTTGGACAAACTCGAGACCGATCTCTGGCTGCGGAAGCAAACGTAAACGAtgTTTTTCTCCGCATTTCCTATGCATAGACATCGAATGACAGCTTGATT
CAAACGGAAtATCATCTTGTGTGTGTGAcGGGATGGGGTTAATGCCGTCTCTTCGAGCTGGAACTTCCCCcACCGCGATTTTCACTACCTCTATCGCCTC
CGCCTGAACTCTCGTCTCTGGACTTGCGCTTCCGATCACGAGAGCGAGAGCGGTCACGTCCTCCACGATCTCCACGATCTCCACGATCGCGGTCGCGGTC
ACGGTCACCGCCTCGGTCGCGCCCACGGTCTCTGTCTCGGGCgAaCTGGTCCTGGCCATCTCGCTCCCTCGCCCGGTCTCGGTCTCGGTCACGGTCTCTG
TCACGATCCGAGCGTGAGCGCTCACGATCGCGATCCCGGTCTCTGTCTCGTTCTCGGTCACGATCACGGCCCCGGTCACGGTCTCGCGAGTCCTTCCCGG
CGTCCTTGTTGTCCTTCTCACGGCGTCCACGAGATCTTGAGCGTGAGCGGTCTCGTGCTGTCGACTGGCTTGGCTCTCGTGATCGACTTCCaCCTCTTGC
GCTGCCTCGATCGTCGTCACCATCACGGCCgCGTCCACCTCGACCTCCTCgtCCGCCACGGCCTCCACGTCCGCCACGGTCTTCGGCTCCCCAGCCGCCG
CCTGGTCCTCCACCGTTGCCTTGCCAAAACCCTGGAGGTGGCCCATTCCATGGACCTGGTGGTGGACGGCCCATGAACCCTCCTGGAGGACCACGACCTG
CCATTGGAGGTGGGCCCATCCCAGGgTGCCATCCATGAGgAGGGGgCATGAAaCCCATTGGGGgACCACCTGACCCCCATTGACCATCACCAGGCTTCTG
TTCTCCGCCTaCCTTTGACGCtGCGTCTTGTGCAGCCGCCGCGTTtGCTGCCGTCACTGACTGACGaGCCGCCTGCTCGCGAGACTTCTCGAGTGCAAGC
TGGCGACGCAGACGCAGCTGTTtGGCTGCATAGTCCTGCACAAAAATGATAAAAGTAACAACGTCAGAGCCGAGGAATCCCAACCACTATGCAGCACTGA
TCACTTCGACTCACACGCCACGAGTGTTCGTCAAAACCGTAGTTGAAGTAGTCGGAGATATCAACACCAGGCTTCCGCCACGGCTTATCCTCCAGCATAT
CAATAtccacGTCaaaCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaaatgccgtgagatcgtctaagccgtcatcccctNacctAaTtGATAGATGATTCCGCAATGTGAGTAC
TATGAATCCATCtCTTCAGACCCTTCAAGGACGCCTGTACCtCGGGTTTCTGAGTGTGAGCACTGCCCATTGTCGTGTGCTGTGTGCTCGCCCCGAAGCT
TCCACGGACGTAGCGGTTCGACCCAGTGAACCGTAGGgCCGGCTTCGACTTGGCATCGTTGGTCAGTGTAATCGCAACTTCTTCTTCGTCTTCATCTTCA
TCATCGTCATCACCAGCGCCCGAGCGaCCACTTGCACcaGATCGCTTGTCGGGACCACCACCTGAGCcTCCGGCACTGTGAAGTTTCATCGTCACGCCAC
CGTACAGCTCATCGTCTTCGTCGACTGTTGCGGTTGTTGGCGCTACAAcGACTGGCTTGGCTGCCAGGGATCACAGAACCACATCAACACGCCATACAAA
aTCCTCATCCtCGGTTATCGCCCTTACCAGCCGTctGAGAaGTACCTGCTGGgACGCGTGACGCTGACGTTGTGATGGTGACATCGTCTCCAAAGTCTTC
GTCCTGCCGCACCCAACGCACACGACCGCCTGTCCGTCAGCCACCTGACGTAATCGACATtGCGCTTTCCATCCATATCGCTctCCTGCGCAGCCCATAC
GTCTACGCAAAGCTACACGCGCGCCAAGTGCACGCACCTCCATGTTTCCCTTCTCCTCGTCCGGTGTTTCCCCCTTGCAGTTTCCGTCCACGTCCAAAGC
TCCTGTCTGGTTGTACTGTCACtGTTCCTCTTAAGTACGAAGCCTTATGACATCGGTCGGGATGTGGAGATGGgTTCGGTGGTgTACTCGGGTCCTTGAC
CCGGGtcGGGTTCaggCCGCCGCGCTGACTTGCTTTTTGTATGGCCTGGGCAGTGGCGCCTTCGCGGCCAATAGTTTGTGcGGCTTtGTTGGTGGCGGgC
GGCGGCAGTGCGCTGCGGCATCcAGTTcTtGTCTCGTTCGAGGgTGATCTGCAGGTAAGCGGGATGCGATGATGGCGGCCGCcTTCAGGGGCCGGCAGCG
GCCTGTGCAACGCACATGTACTAGCAGTCGGATGCGCTGCGCTCTCCCCTCCTTCCTCGTGCTTTCGGcGTCGCTCAGCGTGGTCTACATcGCGAGTTAT
GCGACCTCGAACCGACCCATCTGACAGCGACCGAGTCGACGATATCGACTGGTAGGATGCAAGCACAGTGTGGTGGAATGCAGAGGGTTTCgTCGATGCT
GTGAGAAGTCGAGCGATAGAgAAGCGGGCCGACAGGTACTAGTGATCGGGAGACAGCATGAGTGTGGAGATGCAGTCGACAGTGACGAGTACTGAAGGAC
GGGAACTGGACTCGAGATACGACGGAGGGGAAGAGGGCAAACAGCGAGACCTGTGGTGCACGTGCTGCGAGagTGTACCACTGCAGTGCGCCCTGAATGG
CGTGCCTTTCAACACAGTGAGCAATGAGCTAAtgATGCGTGGTGCCGTCTGCAGTCGAAAGAACAGTAGAAACAATGCCACACTCCTTTGGTTACCGCGC
CCGCACGCGCGACATGTTCGCGcGCCCATTCCGTCAGAGCGGTGTGATCAAGCTCTCGACGTACCTGCGCACGTTCAAGGTCGGCGACTACGTTGACATC
AAGGCCAACGGTGCTATCCACAAGGGTATGCCACAcAAGTTCTACCACGGCCGCACTGGTCGTGTGTACAACGTCACCAAGCGTGCCGTCGGCGTGCGTG
TGAACAAGATCGTGGGCAACCGCGTGATCCACAAGCACATCAACGTCCGCATTGAGCACGTCCACCAGTCGAAGTGCCGTCAGGGTTTCCTCAACCGTGT
CAAGGAGAACGAGTTGAAGAAGAAGGAGGCCCGTGCCACCGGTGTCCGCGCTGAGATCAAGCGTCAGCCAGTGCAGCCAAAGGCCGCCTACACCCTCAAG
ACCAAGGGTGCcGTCCCAGTCACGATGGCTCCTCAGCCATTCGTCGACCTCATGTAAATTGTTCGCAGCGTCTTTCGCGTCGCTGTCGTAGTGGTGACTC
GCCGACTTGTCGGTGAGCTTGTATAAGCGCGTCGCCATTGCGCCGAACAGTATACCAAAAGTGTTGGCATGCAATACAATCAAGAACGAGTCATGGCCTG
CGCCTGCTTCCCTCTCTTCTCTCCTCCTCAT