Description :
From Genome Similarity Track
Location :
Scaffold_244:36450- 37556
Sequence
1106 bases(100 bases per row)
TCGATGGCGTGACAGGTCACGTAAATGGTGAAGTCGGCCTTGCGGTTCTCCCATCATTAAATGATCTGTTATAGCTAGACGAAATTACCTTTAAATGAGT
TCAGTCAGGCGACTTATGCGATATGGTGGTCCTTAGAACCGATAATGAGCTGAACTCCTCGTCTCTATTGAATGAGATGGTTCTTTAGGTACAAAGGCGG
CACTTAGTGAACGTATTGGATCTTTCATTTTAAAGAATCCTTCAGATCCCTACTATCCTTTGGTTAAGGAATTTCAAGATGTGGTATGTCATAATCCACC
ATCCGTCCTACCTCCCTATAGTGGTGTACGTCATAAAATTGACTTGGTTTCTGGAACCCAATACTGCGTTACACGGCAGCTGCCTTTACCGAAGGAACAG
TGTGACGTCATTGACGAGTTTTTCAGTGCTAAGTACGCGGCGGGAATGGTGCGTGAGACCAAGTTTTCTCATTCCACGCCGCCATTTTGTGTAAAGCAAC
TTATGGTAAGTGGCGTATTTTGCATGCTTATAATACGCTTAATGCGGCCACTACACCGGCACAAACACCCATTTTTAGAAAGGACGTTCTTCAGAACAAC
ATGGCAGGATGTACAATGCATGGTGCACTCGACCTGGTTGATGCTTATTATCAACTGCTCATTCGAGCAACTGATATACCGCTTACAGAGGTTAAAACGC
CAAGCGGTATGCTTTGGGAGTGGCTGGTTATGCCCCAAGGACATTCTAATGCCTCGGATACGTTTAAACTTCTGGTGACACAACTTTTCCGCCCTCACCG
TGCTTATGCACAAATATATTTTATGACATATTTGTCCATAATCGGGCGGAACAGGGTCTGTCGGACTTGGATAAAAACATCGACCATTTACGAGCTGTGC
TCGAGTGCATGCGCACTAATAACCTCTATGCTAATGCATCAAAATGTATCTTTGGTGCGGAAGAGATCCCATTGTTGGGATGTTTCATTTGGAAGCGAGG
CCTTCGGGTGGATCCTGCAAATGTGAAGGCCATACTTGATTGGCCAGTTCCTAAGAAATAAAAGGATCTACGCAAGTGGCTTAGCCTTGCCAATTACTTG
CACAAG