Description :
From Genome Similarity Track
Location :
Scaffold_209:3645- 4929
Transcript NameFunction/comments
Phyke_g6505hypothetical protein PHYSODRAFT_525772

Sequence
1284 bases(100 bases per row)
gatgtcCTCGAGGTCGGGCATGACGGCATGCCACAGGAGATCTGGGACGACATGGTCCAGAACGAGCGCAAAATCTTCTACATGTTCATGTTCCTGAACG
GCTCCGTGCTCTGGGCCTACTACTCGTGTCTGAGTGCTCAAGATTTCTACGAAGTGCAGTTCGCGGATTCAGGACTGGACTTCTCGTTCTTGACGACGCT
GTGTACGTCTTGGCCGATGGCTCTAGGTCAAGGTCTGCAGATGTTCTTTGGCCTGGACAAGAAGTTCTCCCGACAGTTCCGAGTGCACGTCGGCTACGGC
ATTTTCATTGTGATGGCGATTCTGATCATGGTCTTTAGCGCCATCAATTTCTCCAACCAGAAGACCGGTGCCATCCTTGTGCTCGTGTGTTTTGGCATTG
TGGGGTTCGGCAACTCTCTGACGGAGGCCACGTACTACACGTTTGCGGCATTATTCCCGATCAACAAGTTCTCCCAGGCCGTACAGATTGGCAACGGTAC
CGCTGGTATCTTCAACATCACGCTGGCCACCGTCTTGCGTCTTGCAGTGGGTGGCGTCCACCAGACCAGCGATTCTACCAAGTTATCGTTCTACCTCTTT
TTCGGCATCCTTATcgttgtgctgcttgtggcGCTCGTTGTCTACTACCGCTTAATGAGTCTACCGTGCGTCAAGTATCTGCTGGAACGTAATGAGGAAT
CCTCCAAAGCTGAAAGCTTGGCCTCACAGCCTATGGGCAAGACGTTTGGCAATCTGTGGCGCATCTTTTGTATCATCTGGGTGCCTGCATTGGCTCAgtt
cctcatcttcttcgtgtcgCTTACCGTGTATCCAGGCTTcggttgtgctgctgcacgtaACCTGGAGCCGCCATATGCGGATGTCGTCCATACTGTCACG
GAAAACTGGTATTGCTCACCTGGAATTGTCGGTAGCTACAACTATGGCGATTTCTTCGGTCGTGTGTTCACGGGTGCTGCTGTAtacaagctgctggata
gTAATTGGTGTTTCGGTTTGTCTGTCTTGCGTTTGGGCTTCATCCCGTTGCTGCTCATGGGAGTGGCAGGCACGTCGCTGTACTCGTTCGGTTTTGATGA
CATGGGCGCCATCGCGTACAACATCGTTTTGAACCTGATCATCGGTCTGACAAACGGATTCCTATCGACGGTGACAATGGGCGTTGCGCCTCGGATGTTG
AACCCGGAGGACCGCGAGTCTGGTGGTGCCGTGATGGTATTCTGCCTGTTCTTGGGCATTGCCGCCGGTTCGACGatcggcttc