Description :
From Genome Similarity Track
Location :
contig_38:364371- 394327
Transcript NameFunction/comments
g8390.t1hypothetical protein
g8391.t1XP_009515448.1 hypothetical protein PHYSODRAFT_536873 [Phytophthora sojae
g8392.t1XP_009515447.1 putative glycosyl transferase family 48 protein [Phytophthora sojae
g8393.t1hypothetical protein
g8394.t1RAW41919.1 hypothetical protein PC110_g1911 [Phytophthora cactorum
g8395.t1hypothetical protein
g8396.t1hypothetical protein
g8397.t1hypothetical protein

Sequence
29956 bases(100 bases per row)
CAGTCGCTCTCTCAGCTACTGCACCTCGACCCGATCAGCTCCGGTGGATCATTCAGCAACAGCAGCATACATGTATATCGTATCTCAACAGCAGTCAAAT
GTCCAGCAGCAGGCGCAGGTCAATTATCAGAAGCGACTCAGTCACTACCGGTAGCGTTTCCTGTTACTACAGTAGACGGCGACAGACTTTCGCGCTGCTG
CAGCCCGATCTATGAATGCTTTACGTCCCTAGGCAGCATGCTTGGCTTCATGTACCAACGTAATTCACTGCGCCGGCTCTTGAGTCGCAGCTAGCGCACC
TCAGCCTTCCCGAAGACGCACAGGTATCACTGAGCGTAGCCAGCAACAGGCGGTGGCTAAGTATGCTGACGAAAGAAAACGTGATGAAGCTCTTGGATTG
GGAAAACGGAAAGTCCCTGCTAAGGGTGTCGTGTCGAAGAATAAAAAAACATGCTACTCCGCGCTTTTAGAGCCGATACGCATGACCTAAAGATTCCTTT
ATAGTTTCTTTTGGGAGTTTACTTGCAGAGGAACATCATAGATCCGACCGCAAACTTTGTCCGACAGAAATCAGCTTCAAAGAAAAAAGCGTGACCCACG
ACTTCGCATGTTGTTCCCTGAAAACGCCAACGTAGACTGCGAACAGTTAGATGAGCAGCATTTCACTGGAGCTGAAAGTGCTCTAGCGTGCACGAGCACT
TGGTGAACCAAGCATTTGGAGCAGCCTACGTTGATCACGACACAAGCATTAACTATCGGATGGCCCAAGCGGATTCTGGTTAGTTTTATAAATCATCTAC
ATCAGTACAAAACTCCCTGTTTGCTTCATCCAGCATCTAACACACACGTGCTAAGGTGAAACCAAGTGCTTTTGCACAATAATTATCAATCGGTATTACT
TCGTACTTCAGTATCCTATAGCGATATGATTTCCAAAAAGCGGGGTCAATGAGTTTTAACCTTGGTTGGCGACTTTCAAAGCAAAATTGGCTTGAGTGAC
GAATTGGATCAAATATACATGTAGGAGTGCGTAAGATGGTATGGTTGTCAATTTCTAAACAAATACAAACCGTAGCGACAAGTTGTTGTAGCTGCAGTAG
TTGAAGAAGATATGTTGATGTGCCAGCTTCACGTCAATCGGTGGTCAAAATGCATCTCGAAAGTTGACGTCAGGAAAAGCACTGTTCAAAATGGGCTTGA
CTGAAGCCTGCCTTGGTAGCCCAGTTCGTTGATCACTGCTTCGTAGTACTTAACTATTTCAAAAGTGCGTTACAACTCTGTGTGACCAAACAATTTAGGT
GAGTCAACACTTGATAATTCATCAAACATGCTGCAGTGTTGACGAGACCAAGTTCGAGTCGCAGATCACAAAATGGTCATTGGTGTTGATAGAACACTCC
CTTACACACGCCTTGATATATTGTGGAAGGTATCGTGCTGTGCGAATGCAACCGAGCAATACACTGCAAAGAGCATTCGCTACTGAGTTATTATTGGAGG
AGTTGAGCATCTGAACTTTCGTCGTTCTCGAGTCTTGCTTGCTGGCTGTTGTTTCTTTCAGATCGATCTATGCAGGCCTAGATAGTGGCATGATGCCCAG
TCCAAGCATACAGTTAAACAGTATCCGCGATCTGGTCCGCCTCGCTGGACAAGAAACCCAGCTCGTCCTCTTCGCGGATGGAGGGGCAGTCGCGCAAAAT
AGCGTGCGAAATAGCCAGAGCTCCGCTGCATTTATAGTAAAGCACAATATTTAGCAAGCTGACCACATCCGCAGTCCTAGAAATCGCTAGCACTTACCTG
GCCGAGCAGATCGTGAACAGGATGGATCCTCCAAACACGACAATCACAGCGGCGCTCACTGCAAATGCAGTCGCAAAGCATACGCGTTAGCACATTTCAC
GCTAGCTACTGAAGAATAGTGCACTAACGTACCACCGAGCATACCGAGCTTCCGCTGGTCGGGTGTAACCGTGCGCCCCATAATCTTCGTCGGGTTCTCG
GGCGACTCATTTGCCGTCGCGCTCGACATGTAAAGCCAAAAGCCTCCGAGGCAGATGAGCACAAAGAGGAAGAACGGGTTCAGCAGGCTGCACCAAAAGT
ACAACAGTCAGCAACGCGTCCTCTCATCTCGCTGGCGACGCAATGCACGGCGTCGACGTACATGGTGACGACGCCCACCAGCGCCGCGGAGATGGCGTAG
TTGGCGCTGAAGAACAGCGCGTTCTTGCGGCACCGCGAGGCCAGCACATCGCGGCCAGGCACATTAAACGGCTTCTCTTCGCCTGGTAGGTCGATCAGCC
ACAGCATACCAGTTAGCATTGATAGAAAGGGACTAGGATGGAGGAGAGCGGGGAACCGCACCGAGTCCGAAGAACTGGGAGATGCCGCGCACGTTGCGGA
TATCGACGGCCTTGACGAGCTGGTTTCTGATCTTCTGCAGCGCGTGCTGCGGCACCTCAATGGTGATGGAGCCCTGGGGCTCGTCGGACGCGACCTTCAT
AGCGCTCATGGCAACGGCGGTGCTTGTCTGGTCGTCGAGGGAAAGAGAAGTGGCTTGGGCACAGAGAAACTGTTGGCAGGCTCCGGTTGGCCAGAATAGC
ACACAACTAGCGAATCAAAAATAGGCTGAATTGGACCAATCGTTGGCCACCTAAGATCTGTCCCTGGAGTGATGGTCACGCTTCAACTTGCATTCCGTAC
TCGCTCAATCACCAAGATGCAGACGCGCCGCCAGAGCCTCAAGGCGCCGATGAAGAAGACCTACGAGCTGGACGACTCGCCAGAAGAGGACAGTGAGTGC
GGATGCGCCTGCGCTCGCAGCTTCGACCGACCTCGGCTGGCTGATGGGCAGCTGCAAGAATAGCCGGCGTATACATGGGTCTTATACTAACGTCACGCCA
TGTCCAGGCTGCTCTTATGATGACAAGGTGGAGCTTGCAGCTAGGAATAGCTGAGTAAACACGGTTGACGTGCTTGCTTTTGTGCAGGAGAACGCGGTGA
ATGCAGCGATCCCAGGACGAAACAGCAAGAGGAAGGGCGATTTGGAGTCTCGCTCCGGTCGTGGAGGCCTGTTAAAGCGACAGAAGACAGAGAATACTGC
GAACCAAGAATCACCACCAATATTCGCCTTCAAGACGGCGAAGACCTCGTTTCGCAAAAGGAAGGCGCTCAAGCTCCAGAAGCAGCTAGAAGATGAGGAG
AAGAACAAGAAGCGGATCGACGACTTGGTTGCGTACTTCAAGAACTTGGACGAGCAAAAGCTGGAAAGAGCTTGAGATTGGTTGCGGTGAGCTCACTCTT
TTTTGTAATGCCAAAGTGAGTTGCTGAGCGATAACATCGCTCATGCCGACTGGGCAGTCGCTAGCGCAAGAAGCTGATCGCAATAGCGAGGACTTTGGTG
ACGAGTCCGATTCTCTTCCGCCTTCTTCGCCAGCCGGGGAGCGTCGATCGCTACCGTTTCCTTCAGAACATTGAAGACGGCCTCCTGCGCGATAACCAAC
CAACTGAAGAATTAGTACACCTCTACAGCTAAAAGAATCGTAAGGCGATTCAAGTTACGTTGTTGTGCGTCCTTGCTTACCTGGATGTCGGGCTCAGAAT
CGTCTAGGTGACAAAAAGGCAGTCCAACGTGTAATCGATGATTGTTCCTTGGAAATGCTCTATCGGCGCAGCTTTCAAAAAGGTGGTAAACGTCTGACAC
GCCGCTTTTCGCACAGTGTCATTGCTGTCATCGAGGCGCTTCAGAATCTCGGCGTAGAGTTGATGAACTGGTTCCTCTGTAGACAACAATCACAATAGCT
GTTCGTGAGAAATATGCTCCCCCCTTCTGAGAAATAGACGTGCTTCATACCCCCCAAGCACCCAGGCAATGCTACGAATAGATATTGCAGCGCAAGGCAG
ACCAGTTGGCGAGTCTTGGCATCGCTGTCGTCCATCGAGGATTTAAGCACAGGCAACATCTACGATGATAGCAACAGCGCAGGTATTAGCACAAGCACTA
ACAATCAGAGAGGGTACTACCGATACACAAGCATTTACCTGAGGTGCAGTCTCAAACAAGCACGGCTGGTCGGCAATGCCGTGGCGAAGCAGCGTGTATG
CACAAGCAACAGCTACTTTTCTGATGGGTGCAAGTAACAAGTCTAAGCATCAGTACTACAGGAAGATAACCTTACTCAAAGCATTTATCACTCACCTAAT
AGTTGCAGCAACACGCCCTCCACGCCACACGATGTTCGGAATGATAGTTTTCTGGAGCAAAGCAACACTAAATGGCTTAAAGGCCTGGAAAAGTAGTAAA
CACAAGTCCATTAGACACGACATGAGCCATGAGCAAAAGCTACGCCGAGTGATAGCGTACCTGGCTGATAGCATCCGTCCCTAGCATCGTCTCCAATAAA
GCAAGGAAAGCGAGCCGGACATCCGCATCTTGAACTGGGTCGAGGTGCACCAAGAAGACGGGCACAATTTTCTTCAAGTTTACACCGCATGCCTAAACGA
AGCAAACCAAAACGACAAGTTAAAATGGGCTTCTAGCAGAGATACTAGAGCATAGAACGTATTATACCACTCCTCCACGTCGACAAAGCGAGTCGAACAG
TACGCAACTCGGGTCGCTTTTTTGCCAACTGTTTGCTGCTTCAGTGGGAAGCCTCATAGTATCCAGAAGCTTGCCCATGTAGCGTGCATAAAGTACCTAA
AGTCAACCGAAGCCATGCAAATTAGAGAGTACTTCACCCAAACGAATAAAATGAGACTAACCTCAATAGGCTGCTCAATCTTGACAGCCAGATCCAACAT
AGCTTCGCTTGCCTAATTCCATTCCAACGACAGTGTTAGCACCTTCGCGCATTTCAGACCCAGCAATACGTCGTGCAGGTAGTATACCGTCTCATAGGCA
ACTGATGACTCTGGTGACGCAGCGAGGAGGTGACTCAGCACCCAAAACAGTCGGAAGCAGATCTCATCTTTTTGCGAGAGCAGCGGTGCAGCAGTCTTAA
TAATACTCGCGACAACGCCAGCCAATTGATCTTGCAGGTCTGATACTTCAGACTCGCGCAGACCAGCGTCACACAATGCCTCGGTGATCAGCTAAGCGGT
GATCAGCACAATGATAAGAGCGGTTAGTTATAGTCTACGAAAGTTCTTACTGATGGCAATCCGTGCGTACCTCCAGGTGAGCTCCAATCGTCTTTGTTGT
CATGCCTTCGATACTCATACCCAGCAGGACTAAGCCATTCGTGCGGTGCTGCGCGGTATCCTGGCCGGCCAGCCTACCTGCCACCATTGGCAGCAAAGAA
GCCAAAATCATTTGGGCATCCGCGTAAAACCCGACAACACCTGAGCAAGCCTTCACACTGTTGAAGACGGGTTCCTCGTCGTCACGGCACGTCTTGCCTA
ACGCCGAGAAAACCTTGTCGAGGAATGGGTTCACGTTCTGCTCTAGCAACACCAGGTACGCACTGAGAACTTGTGTGTAGCGTTCACGCACTTGCACAGT
CCAATCCCCCGTTTTCTCGAGAAGAAGCGACAACACCTGCGCTCGAATAGTCACTGCAAGTTTCCGAGCTCCAAGTGGTGGGCGAGTCTCAAAGAAAAGA
GGTGGTGTGTTCTTCGCTGAGTCCATATCCACCTCCATCGGCTCTACATCGTCCGCCTTAACATTTCATCTTCATCCCGAGCCTCCCAGATTACTGAAAG
TTCATTCAGTTTAACGAGAGATAGCTGCCGAACCTCGGGAGCTTCATCGATGATTCCCGCCAGAAAATGGGGAAGATGGACGCTTCATACTGCTGAATCT
GCTGGATCTGGGCTAACCACGCAGCCAGCGTGATCACTAGTTGCTTCCTCACGGACGGGGCATGGTCAAATACAACCTTCTCAACAGCTGGGAGAAGCAC
CTCCTTGATGAGCTCCGGTAAAGCCTCCGAGCCACAGGGAACCGCAGCTTCCAACGCCTGCAATGCGCATACGCGCACGCGGCTGTGCTGGTGGCCAAGA
TTCACAACCATAGGTCGCACAATAGCGCCAATCTGCAAGGCCACGTCGCTCTTCCAAGTCGTCGAAATCAAGATGACGCACTCTGCTGCCATCTTCTTGG
CGTCCGGGAACGGGTCCACCGCCGTCTTGCCCAATGCGTTGGCCAGCTCCGAAATAACGTCACGCAGTGACGTCGCCGATACTGTCACTGCTGCAAACTG
CTTCAGGAATGCGTGCAGTAGCTGCAGAACGAGCAGGCGGATCTCCTCCGTCGGCTCCGGGTACGGCAGCTTGCCGAGACGCGCGCTGGACAAAGCCACC
AGCTCCTTCAGAGTCGCGTCCGACGGCTCCAGCGCCCCGTTCTCGCACAGAACAGTAGCGATGTGAGCGCTCGCTCGCGGCATTTCTCGACGGCATCGCT
TTCGGCGCATTGCAGCAGCGGGCGCTGCAGGTTGGTTACGCACAGAGCGCGCAGCACTCCAGCGGACACCCGCGACGCCTCATTCTGCAGTGCGCGGTAC
AGTTTGTCCGCGGCACGGCGGCGCACACTTCGATCCGGGTCTGCCAGGCAGTTGACGTCACGCTGCATCTTCATGGACAGCATGTTGTACGCGGCCTCAT
CCTCTGGAGACAGCACCATGGCTTGCAAGGCAGCGGCGTCGGATCCAAAATGACCCGCCACTCAAGTCGGCCATACAAAAGCCAAGTGATGTAAGATAGG
GCAACTTACGTAAGAACTTTATGTTGCAGCAATGAGGTGGACAGCTTTGTCGGCCCTGAACCGGCAAAGAGATACCATGTACACTGTTAGTTGCTCTATG
TGTTTCTGCTGAAACTCATCTACTGTTTGTTGCCTCTATATGAATACGAATTGCTCAGATGCTTCGGACGCTGATTGTAAAATCGCCAGGCTTTGCTGAA
TCGAAGACATGGCTCACTTCTTCTTGCCCTGCACGCGTTTGCGGCCGTTGGCGGTGAGCTCGCGCTTTCGCATGCGGATCTTGGTCGGGGACACATCGAT
CATCTCGTCCTCGCCAATGTAGGTCACAACGTCTTCCAGGGACATCACGCGGATCGGAGACAGCTTGACGTTCTCGTCCGTGCCGGCAGCACGCATGTTG
GTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGCTGTGCTCACCCACGATCATACCCTCATACACCTCGTCACCAGGCTTCACGA
ACATCTCTCCGCGGTCTTCAAGCGTGTTCAACGCGTAAGCCTGTTTCCAGCAAGCCATATTGAGTAAATAGGATTGGGGGCACGAACGATCGTACATTTA
AGCTATCATCTTCCCGTGCACATGCCTCCAGACGAGGAGATAAGCTTGCCCTTCGACGGAGGAGTAGCCGAGCCTTGGAACGGTGAGTAGCCGTGGAAAA
TCGAGTTCAGAATTCCACTTCCGCGAGTGTCAGTCTTGATCTACACATAGGAAACATGATCCAGAGTAAGTCCTTATTCGAGAAAAGTGCTCGGATTCAA
CGCATTTACGCACCTCACTGCGGTAGCCCATGAGACAGCGACTGGGAATCTTGAACTGGAGGCGCACTTTGTCGTGCATCTCCTTGAACTCGATGATCTC
ACCACCACGGGTCGCCAGCTTGTCAATAACCGTGCCAGAGAAATCGGAGTCGACATCGATCGTCACTTCTTCGATAGGCTCCAACTTCTGGTTGGTCTCC
GGGTCCGTCTGGAAGAGCACCTGGGGGGCTGAGACAGACATCTCAAAGCCCTCACGACGCATTTCTTCAATCAGAATAGCAAGCTGAAGCTCACCACGGC
CGTGCACATCGAAGGCCTCCGACGATTTACTTTGAGAAATGGAGATAGCAACGTTGTTCTGAAGACATCAATACACAATCATTCATCAGTGAATCACTCA
GCTCAACAAAAAAGTAAGAAAAGCAAGATCCCACTGACCTCGCATTCGCGCTCAAGGCGCTGCTTGATATGAGAAGATGTGAGGAACTCCATCCTTGCCT
GCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGCGGGTCCAGCTGCGGAGAGGGAATCGGCTCCGTCACGGCCACGTCAGCGATGGTGT
CGGACACATACCGCGTTGACACCAGCAATGGTGATAATGTCACCTGTTACAACGAGTTATGCACAAAACATGAAGTATTAGCATGCAAACGCCTTCAAGC
ATAAAAGAGTGATGCTCTCAAACATACCAGCGGTAGCCGACGTGATCTCCGACTTCGAAACACCACGGGTCACGAACATCTTAGTCACTCTGCCAGTCTC
AAGCTTCTTGCTCTCGCGGTTCATCACTTGAATCAAGTCGCCAATCTAGTCAATGGCACAGTGAAAAAGCGCGGCACATTCAAAAGTCAGTACGAAGTGC
AAGAGCATCATCTAGAACGAGCCAAGCCCACCTTGACAGTTCCGGCGTGTACGCGGCCTGTCGCCAGACGGCCGACGTACGGGTCGTGTCCGATCATTGT
GACGGCCATCGCAAACGGTTTGTCGGCGGTGGCTTCTGGAGCAGGCACGTAGCGAGTGATCTCGTCCAGCAACGGCAGCATGCTGTCACGCGCCTCACCG
TTGTCCAGGTCGTGCACGGCCCAGCCCTGTTTCGCTGACGCATACAGCACAGGAAACTCCAGCTGGTCGTCGTCGGCGTCAAGCGCCACAAACATGTCGA
AGAGCTCGTTCTCCACAGATCCATCCAGACGGCTGGTGTCGCGGTCCACCTTGTTGACAACGACGAGTGGCTTCAGTCCGCGGTGCAGCGCCTTGGTCAG
GACAAACTTGGTCTGCGACATGGGGCCCTCCGTGGCATCCACGACCAGCACCACGCCGTCCACCATACTCAGGATGCGCTCCACTTCGCCGCCAAAGTCG
GCGTGACCGGGCGTGTCCACGATGTTGAGCACGTGGCCGTTGTACTCGACGCGCGTGCACTTGGACATGATGGTGATGCCGCGCTCGCGCTCCAGGTCAA
TGGAGTCCATGACACGCTCCTCGGAGAGTGTGTTGCCGCCGTGCTTGAGCAACTGGTCCACCAGCGTGGTCTTGCCGTGGTCAACGTGCGCCACGATGGC
CACGTTGCGGATGTTCTCAGCCGTGACGGCCGAATAGTCGGTGGAGAAGGCGCACGCCAGCGTGGGCGCGCTGCGCTGCAGTATCGAGCGCTGGCCCGAG
CGCGCGCGCGCCAGGGCAGGCAGGCAGGACCGACGGAGCCACATGTCGAGCAGGTGCAAGCGATTGATACACGAGGTCGGGTGATGTGCGTGTGTGGTGC
AGAGGCGTCAGCGACCAGGTGATGTGGACCACGTCACAGTAGTGTGCTTCACGCCATTTCGGTGGTGCAGACCTGGTACTCTGTACCATCGAATGGATTT
GTTTCGCATCAGGCTGCTTGGGGAAACTGAAGCTGCCTCACTTCGTCAAACGGACGAAGCGCGTTTGTCAGCGTGACTCGAAGGGCCTACTAGTACACAC
TGCATCTGAGCAGGTGATATTACCGTATGCATGCTTGACAAGTCCGTCTTTTTAATAACCTGCGAAGAAAATCGTCAATTGACGCGACGGTGACGAAATT
CGCGGTGACTCGTTCTGTGAGCAACTCTGTAGCAAGAAGCGACGCGAACCACCGACCATTTATACCGGTCCTTCGCAGTCCTCTCGTTCCTTTCACGCGG
TCGCTGAGTACAGGTGTCTGCCCTTTGTATCTTGCACCAAGGCTCACAACATCGCGAGGCACCTTTACTAGACTCATCCGATTTACCGCAGCCTACAATC
AGAAAGCTGCAGCCTGCAGTGCAGGCACTGTCACTTGCGACGACTCTGCTTACTTGCCGCCACCCGGCGGTCAGGTTGGCCGAGGCAGGACATTGGACGC
GCTTACAATCGAGGGAGCTGCGTCGTTCCTTACACTCGAGGGTTCGATTTGGATTAGTGTACACCACACCAGGCGTGTCAAATGGCTACCGGTACATGTA
ATCAGGCGTGTCACGCTGAGCCGAGCCGAGTACGCGGCCGATTCTTGGCCCGCGTTGCACCATGTTGGGGCAAGTGCGTGGCGGCGAGTCGCCGCTGTCG
AGTTCCGCCTCGATTGAGGAGACTGCAGTCATGGCGAGCTCGTTCTCGCTTCGCCATCGGTCTGTGGTGCTTGGAAAACATGAGCAGGATGCGGCGCCGC
GTCTTTGGAGGCCAGTGGCTTCGCATCCTGCGATTTGAAGGACTAACTGCAACCTGCGGCCCGATCTCTGCTCAGAGTCTGAGCCGCAAACAGCGGATCA
AACACGCTCCCCGATCGTTGAGGCTGTCCATAGAGAACCACACAGACGCAGGGCTGCTGCTGCTGCCGCGCCCGCGGGCAGTTTGTGAATCAAGCGCGGC
CAATCGCGGCGGCGCGGGTATGGATAAATCAGGATTGCCCTCCTCTTCCGCGCTTGACATTGGTCTCTGCTGCAATGGCAGCCAGCAAAAGCCACTTTGC
CGCGACATTCGCGCTGCCAATGCCTTCGCTCGGACCGGTGAAAATTCAGAACTGTTTGCGTGCGAAGGTCGGGCCGAGGGACCAAACGAAGGGAAGGCGG
GGCGGATACATGTGTCCACCCGCCTCGCGGGAGTGCACTGCAGGTCGTTTGCTTGGTGCTTGGTAAATAAGCAGTCCTTGACCAGTGGTCAAGTCCACCG
TCAGCTGCAGATACCACCGTCCCCCCCCCCCCCACCTTCTAAATTGTCTAGCGGGCCGGCTTTGCCTTGTTGTTTGTATTCAGCGAGGCGCAAACCCGCA
GTCCCGGCCCGGGTTTGTGCGCAGCCTCTATGCGATCCCAGACGTTTGATGCGGAAGATCTGTCCGAGCCTTCATTCCGCATTTTGCAGGCCGGCGTTGC
CCTTCCTCCTCCTCGAGAGTCCCGAAGAAAGCCTTGTGCGCAATGGGCCGGAGGACCTGCGCGCTGCTGCTGCTGGCGCTCACGGCGCTGCTACTGCCCG
CGGGCGGCGAGGCATTCCTGCCCATCACACGCCACAACCTCACGGCTCTCCAGAAGCGGTGGATCGACCCGGACACGGACCCCAAGTTCTACAACCTCTC
GGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAACGCCAGCGAGATGAACGAGTACACGCTCATCTTCTCGGACGAGTTCAACAGCTCCAAG
CGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTCGACATCCGAGATACGACCAACATGGGGCAGCACTACTTCCTTCCCCAGGCCGTGCAGA
TCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGAAGCGCTACCGCGGCACCAAGTACGTCAGCGGCAGCGTGCAGACGTGGAACAAGTTCTG
TTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGGCAAGTGGGGCATCCCCGGCACGTGGCCGGCTATCTGGATCATGGGCAACATTGGTCGT
GCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGCTTCGATGTCTGCGCCCCCTTTGTGGAGAAGACCGAGAAGGTCAAGCAGAAGATTAGTG
CCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACCCGGAGATGTACGGCTTGAACCCGTTCCAGGGTCGTGGTGCCACGGAGATTGATGTGAT
TGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTCGACGTCGCTGCAGATCCGTCCTAGTCTGTCTGAGGACATGCGTCCGGGTTCGGAAACG
CTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGCGAATTCACGCGTATTAACAGCGACTACTATGGTGAGGTTGGTCTCGACTCAATCTCAG
CTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACTTGTACCGCCTGGATTGGTCCCCTGGTCCAGAGGGTTACATCCGTTGGTGGCTCGACAG
TGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTGGGTGGGTGATGTCCCTCCTCGCCAGCTTCCTGTGGAGCCCAGCTACATTATTCTGAGT
ACTGCTGTCTCTGAAAAGTTCTCCCCGCCGTGCGATGGTCAGATTTGTGACTCGATATGGCCCTCGAACTTCACGATTGACTATGTGCGCGTGTACCAGG
GCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGCGTATCCTACGAATGAATGGATCTACTCGCATCCGGTAGACTATGGTCTTCCGTGGTA
CGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCAGTGATTAATGCTCTTGTGGGCTTTTTCATGGCTTTCCGAGGCACGTCTCACCCGAAG
ACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTTTTATGGAGCGATAAGTGCAAGCGCCCCAGAAGAATTTGCCTGGATCCAGACTGCTG
TTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTCGTGTACCCGATTTCGCTAGGTGCGATGCTTGGTTTGTATGGTGGCGTAATGATAAG
CCAGTTCGTGCCTCTGCTTTCTACGCGGGTGATCACTGCTGTGTTTGTGGGTGTGGGCATCGCGCTGGGGTGTGCGCCGCAGATCGACACCAAGCACATT
GTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCTATCGATTTCGCTTTGGGTGAGCGAGGGTGACATTGCCGACAACGCGTGGAACCTCG
CTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTTTGCTCGGAGCACTGCTTAGCGATGTATGCGCTTCTTCTCGTGCTCAGTGCGGTCAG
CACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCCATAACGCGATTAGTGCGCGCAAAGCTAAATTCCCGCAGGTTTCTGCGAGTTCGGAC
GCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAAGAACATGACCAACTTCTTTTCACCGAACAAGCTGCCGCACAACATGCAGCAGTTCA
GCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGATTCCAACTTGACAACTTCCGCAACCAGACAGAGCACATCGTAGTGTTGCTCACGAA
CAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATTTGGTGTTTTCTAACTATAACAAGTGGTGCTCGAAGTTGAGGATTCAACCGCTGCAA
TGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGACGAGATCTCGGTGGACTTGTGCCTGTTTTTCTTCATCTGGGGTGAGACTAGCAACC
TGCGCCACTCTCCCGAGTTCCTGTGCTACCTTTTCCATAAGATGAAGGAGGAGTTTCCGTCGGTTCGTCACTCCGAACGCGAGGCTGGATACTTCCTGGA
TACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGATGTCGAAGCACGACCACGAGGACCGCCACAATTACGATGACTTCAATGAGTTCTTC
TGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGTTCTCGACATGACGTCGCCGAGCCCTGCCATGATTTACCAGCAGAAGAAAATGCAAC
GTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGTGGTTCCAAGAGCGGCAATTTCTTCCAGAAACGCAAGAGTATTGCTGAGGGATTCAC
TGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTACCGCTGCGCGCCTTCAACCGTATCTTCAATTTCCACGTGATTTCATTTCACTTGTTG
GCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGACTTGTGCAAAATCACGTCAAGCACTCTGATCACACCCTTCTTGCTGGACATTCTGC
GTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGAGCGTTTTCGACGGTGCGTAATGTTTTGCGGGTGCTTTTGCATCTGGCGCTTGTTGT
GACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTCTGTGGTGGCAGACGTACTACGTCGTCACGGTGATTTTCCACGTGCCTGGGCTGATC
AACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCGACGTACTACGTTTGTTCCCATTGCCTTTATCCGTGATATTGTGAGCCCGATGAACC
GCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGCGTGGGCTACCAGTTTTTCTGGGCTTCGCAGCTTTTATGGAAGTTGTACTTCAGCTA
CAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGTATGCCGACCATGTGGAGAATAACGTGAGTATGATTACAACGATGTTTCTCATCTTC
CTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCACGATTTGGAACTCGATCTGGATGGCTTTCACGGGTACCTTTGTGGGCTTTTCAGCGC
ACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTTAGCCGTGCTGTGGATGCGTTCAATGCAAAGGTGATCGCTCGAAACTCGAAGACTGG
ACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCGCTGTTGGCCACGAGGTGCTAGATCGCGTTGCAGGTGGCGCGGACCCGACGTCTCGA
ATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCCTCTGCTCTCTTTCTCGCGTCGCAAGCAGACACCAATGGAGCGCCAAGCTGCTCGTC
GGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCGACAGCATGCGCGCGGACGATTTGATCTCGAACAGGGAGAAGGCTCTGCTTCACTT
TCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTTCCAACTGGCTGGTTGCTTCGAAAACTTCACTTCCAGCATCCTTGACATTTACTCA
TCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTTCTGGAGATTCTCAGTGAAAGTCCGATGGTGGAGGAATCCGTCGAAGAGATTTGGG
AGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCATGCCACAGCAACGATGTGAAGTACATCACGAGTGTTCTCAACTCATGGGCAGCACGCGGTGT
ATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGCTTTGGCTAGCTTGGTGTTGTTATTGAAGTCCAACGCCCGTGCCTGGAAGAACGGC
GCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCGTACGAATTCCCGCAGCAGTCGAGCTCGTACCGCCCTGCTCCGTCGGGCCTTACAA
AATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTCCTCGTCGCAGTCGTGGTTCTGGAGTTGCTCGTATTGCGCGTATGCAGCAGCAGAC
GCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCCGAGCGCTCACATCATGCAGATCCGCGAGCGTGTGCGCACGTTCCTGAACTTAGTG
AAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACGGAGAGCAAGGGTATTTCGGACCGATTGACATGGATTCTTACGCAAGAGCGCGGTT
TCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGTCGTTTGAAAGCCACACGGACGTGGTGCTGTCACACCTGCATGGACTTCTTACCTT
GCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCGTCTGCTGTTCTTCGTGAACTCGATGTTTATGGATATGCCGTTGGCGCCGTTGCTC
GAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAGGACGTGCTGTACTCAAGAAAGGATCTTGAAAGTAAGCAGGATGGTTTGGATGTGC
ATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGAACTTCCTGGAACGAGTGAAGCCGAAGAAGAACATCTGGAAGGATCCAGAGACTGC
TATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTCGCGTACGGTTCAGGGTATGATGTACGGTGAAGCAGCCATTCGACTGCTTGCGGAG
ATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACGAAGTTTACGTACGTCGTGGCTTGCCAGATTTATGGCCGCCAGAAGAAGAACAATG
ACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGAACCTCCGTGTTGCTTACATCGATGAGGTGCGCGTGAACTACCAGAAAGAGCAGTC
TTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGTGCATGAGATCTACCGTGTGCGGCTGCCAGGCAACCCCATCTTGGGTGAAGGTAAG
CCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAACTTGCAGACAATTGATATGAACCAAGACGGATACCTCGAGGAAGGGCTCAAGATGA
GAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGTTCACAATCGTGGGCATCCCAGAACACATTTTCACGGGTAGCGTGAGTTCGCTGGC
TAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCAGCGTACACTGGCGCGGCCACTGCGCATGCGTCTGCATTACGGTCACCCTGATGTG
TTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCCAGCAAGGGCATCAACCTCAGTGAAGATATCTTTGCGGGCTACAACAATTGTATGC
GAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGGGGCGTGATGTCGGTATGCAGCAGATCTACAAATTTGAGGCCAAGCTGGCTCAAGG
TGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCAGCGACTGGACTTCTTCAAGCTGCTGTCGTTCTACTACAACCACGTGGGCTTCTAC
CTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTATTGCAACCTGCTACGCGCTTTGCTTTCACTTGAGGGTGTTGGCGGTCGCGAGCCTG
TACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCTTCACGACTGCACCGCTGCTGGCAACGATTTCTGTCGAGCGCGGCTTTAAGGCTGC
ACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTACTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTTCGGACAGACCATTCTTGCC
GGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAGCACTCGTCTTTCGACGAGCTCTACCGTTTCTGCCAGCAGCCACCTGTATGCTGCA
GTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTTGGCTTCCAGTACTTATCGACGACGTGGTCGCTGTGGCTTGTGTTTGTATCTTGGT
ACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTGACGTGATGGAAGATTTCCGTTTGTGGTTCAAGTGGATGCGCGGTGACGGTGGCAA
TCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTACTTCTCAACGCTCCGTCCGTGGTCCAAGGCGTGCATTACGGTCAAGGGTGGATTG
TTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATATCACTCGATCCTGACTGAGTCGACGTGGCTTCCGTTGGTAATCTGCTGCTCCATGG
CTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGCGTTCCAACGGTGAGAATGGACTTGTTCGATTCCTGAAGCTCATATTGGTGCTTGT
GCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTATGTGGCAGTGTCTGCTGAGCATGGGATACCTCGCTGCGGCTGTAGGCTGCTGGGCG
CTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTACTTTGTGCACGATGCTGTGCTCGGTTTGGTGTCGTTGAGTCTCATCCTGCTGCTCG
CGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACAACAATGCGCTAAGCCGCGGCGTGGTCATCGAGGACATCCTCCGAGCCAACTCAAG
CAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTCGATCATCATGGAGCAGCAACGATTCATCAACGTACTGACTGCCAGCGGCAGTGAT
GCCGACACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCACGCTATGAGCGACAACACGCTTAACGCGGTGTTGCGGAACATGTCGGAGACGGAA
CTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATGTCGGAGGAAGAACGCAAGGTGGCGCATCGCAAGAAGCAGCAGGAAGAGCAGAGAC
TCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAGCCTTCTCCACGAGCGATTTTTCGGCCATTCTGCCGAACGCGAACCCCTTCAACCC
CCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGGCCACACTGCCGTGTAGATAGTTAGACGAACTAGTAGGTAGAGCCATTGACGATGG
CTTGCTTTGCATTTTGAATGAAAGCTACTGTACCTGTTGATGTTCACACTATTCTTTTGTGTTGCGCGCATGCATTGCATCCTGGTTACGGTGATGTTAT
GGAGACTTCGCAACCAAGTGATTTTCGGGGATAAAAGAAACTTCAGTGCAGGGCCCATTCAAGCAGCAGGAACGTGCCAGGTCATGGCAATAGCAAGTGC
ATGGAAAAGAAGTGAGACCAGAAGAATCCAAGTCTTCAGCCTGGCCATTTGTCATAGCATTATGATGACTACCGATTCTGCAAAACCAATTCCAGCTCTC
TCCAATTGGAGAATTCAATATCAGCACAACCCCTGAAGAACAAGTGAACGGAGGATGGATATTACTGAAAGAAGAAAAAAAGGCGTTATGGAGTGACAGC
GACGAGCATCAGTTTTCCAACCCAAGGCACCAGACACGCCAACGCGGTGAAAATGTTGGACAATGGTCTCCGAGTCTTCAAACAAATAGGCGACGCAACA
AGGACATATCTCCGAATCGACAGTGTGGATAAAACAATTCAGAAGACCCTCAGTGCAAATCCAGACACAACTTCAAACACGGGCCACGCCCAGGAACTGG
GCTAAGAGCTACAGCGTTTTTTCGATGTACAACGGAGCACACCAGCAAACACGACCTGGAAGCAATTCGGACACTGGCGAAAACACAATTCTGTCTCCCA
CAACAAAGAAGAACACCGGATCCGCTGCAGGACTACCTCACCAACTTCACGCAACAAGATTCAGCGCCGCTACGTCAGACGAATGACGTCTTTTATATTA
TCAAAAGACTTCTATTGAAAAAAAAACACGTAACAGCAAATAGAAGACCACTTATCATCGCATTGCATTCCTGGTTGTGTACAGATAGCACAAATGCTTG
ATTGTTACTACTGTAGTGGTGGATACGCTACGAAACACATACGTCGTACATGTACTTCGCTGAAGTACAGTAGGTAAATACACACATAGATTCCATCAGT
AGCGTCAGGGCTCTAAGTGCCAGTAGGTAGCAACAGTTTGGCGTCGAGAGCTCAACGATCTATCCATGGATAGCGCGAATCACTGGTCGGACTGTTTCCT
GGGCTTTTTTCCGAAGCCGAGGAACTTCATGTTGGCGCTCAACTTTTTCGACAACGAGTTTTTCTGCAGTGGATCAGCGCTGGTCAGCACAGCTGCCTTG
AAGTTCTCGGTCACCTCGAGATCGCAGTCGCAAGCCTCTAGCTTCTTTTCGATCTCGTCTAGGTTCTTCTCCGAGACTGAGCGGATCACTGCCAAATCAT
CGACAAGCTGCGATGAAGACACGTGGGAGTAGATCTTGCGGCTGTCGGACGCGAAGCACTCGTCGATATCTTGGCTCGGAGACATGGCCAAATTGGCGAA
GAGTTGCTGAATTGCTGGCGAATTCTTCTCAATAAATGGATTGAGCACCCTAGACATAAGTCAATACAACATACATGTGTTAGAATGCGGCACCAGTAGC
AACATTCATCATGTGACGCCGAGCGTACTTGAATTGGGGCTCCCGATCTCCAAACTTTACACCGGTCGCTGTCTTGAACAGCAACTTCGTAACTAGCACG
AGCACGCGCCGAGTCTCCGGTGGAGGAAGCTGCTTTGTGAGCCCGTACAAATGCGGGGTAGTGATGGCTGGGCACACAAATCGAAGGAAGAGGAATCCTC
CGATCACCGACCGAGTCAGCGTAGACGCGTCTTCAGCCTCAACGCCCTCCTTTGACCCATCAAATCGACTGATGACCTTCGAATTCAGATCGGAGCAAAT
GTGGAAATACGATGACGGGATCTGCGAGTAAAAACAATAAATTTGGACATTAGAAACTCTCTTGTACATGCCAACGTCGGAATAAGGTACTTACGCAGTG
GGTATTCTTCATGATCGAGTCGATAATGTTCTGGCACGTCTTCATCAGGTTTGCAGCGTTGGAATATGCCTGAGCTTCGTCCTGGAGTGATTCCTCCTTG
TGCGGGTTCAACTCCATCTCGGCAATTTTCAACTTAAATATCTGGTGAATGGGATCTGAGAGTGCCACACGGATAAATTTCGACCCGATCGCTTTGCTGT
ACGTGGAAACGAGTCTGCTCGCATAATCATCTGAGCGGAAAAGTGTAGCCACGTTGATGACTGAAGCCACCTCGATTTCGATTGCCCAGCGAATAAGGTG
GCTAAGGCGGTTGCGACTGCCAAACACGCGGAGAAACGGAGCTAGTAACAGCATCTTGTCTTCTCGTCCCGCACTCTGGAGAATAGATGCCACCACAGAC
ATAGTGTCTTCGATTACCAGTGAGGGAAGATCTTTCGGGGTCTGTGGCATTGGTGCCCGTACTGACACCTCAAATTCCCCGTTCAGAAAATCGCGGGCAG
ATCTTGCATGGGAAAAAAAATTGCGTATCCTTGGGCTTGCACTGGTACTTGAGCCTGTTGCAGGCGAGCCCGTTCGTAAAGCACGCTGGTGATGAGCCTC
TTCTAGATCGTCCGTTTCCTTTGATGGATCGGTATCAATTCTTTGCCGAATCTCGGCAATAATCTCATCGCTGATCACGAGCTGGTCAGGCTGACGTGAT
TTCTCAGGCTGGGATGACACGATGAAGTCTTTCATGACCTGATGAATCGAGTCAAGAAAGCCGCTCGCCTCCAAAAACTGACTGTCAGACTGCAGATTAC
AATACACATACAGTCAGATTCGAAAGCATGCAACGTAAACAGACTACCGAAAGACGAACCGCATCAAACTCTGACAGGCGTTCAATCTCGCCCTCCTCGT
CGTCATCATAGTAAAGATCGTCTTGTGTGATGGAGAAGATGCTATCATTACTGTCGTTCGAGTTGATTTGATTTAGACCAAAATCGGTGACATCTGCAGA
TGTAAAAAGAAAAAGGAGTTAGAAATCACTGGAGAATATTAAGAGCTTCTAGGCGCACCTGAAAAGGAAGTCTGGGATTCGAGGAGCGATGAGGAGCTTG
AGGTGCTTTTCAACGGAGTCTGAAACATAGTAACAAAGCGTGAGTTGGATGTGGACGAACTGTAAATGATAAGATGTGACCACCTTACCTTCAATGACTT
AGGGTCTACCCGGAAGGAAGACTGCAGATTGCGCGCAATTTCGGCGAGCTCCATCGCCTGTTGCTGTAAAAAGTCATTTCCAGCGCCGCAACTCGAGTCG
AAAATGCCTGCACCAGTGTGTGAGCCCTTAAAACTGGAGGTGAGGGAGCCATCTTCACTGCTTTCACGTGTCGATGACGAGTCTGTGAGGTCATCTTTAT
TCAGGTTGCGCGCCATTTCTGCCAATTCAGCTGCTTGCTGTTGGATGGATTCGTTCTCTGCAGCGTCATTGAAGTTAGCTGAAGTCGCACTCAACGGATA
TGTTAGCGACTCTGCAGAAACAGGGCTCGTCTTTTGAGTCGCAGGCGCTGCCACAGCCTCTTGCTTAGGGAGTATGGATACTGGCATACATTCCTGGTGA
GGAGATGCTGGCTGCTCGTGTCCTGCTTCGGTTTGATCCACTCCATTGTACTGCTCGTCTTCATGGGGCGAAGGGACCCCCGCGGACTCAACCACCAGGC
TCACATTTTGGATATGTTCCCTCCCGTCTTCTCGGCTTATATCACCCTGCGCAGCATCGATACCTTCTACCCCGTCCTCGTGTTCATCTCCAGGTACTTC
GTCATCTTCTGAAAGCACATCAGAAACGGCCGAGCCGCGAGACAACTTGGATATTTCCATCGCAGCGTCGTCCAGCATGGCATCCAAATCCAACTCTTCT
CCATCAGCATCGCCTTCCTTTCCATGACACTCCTTGTCCCCGTCATTTTCTGCTCGTGCCTCCAACTCGTCACTTCCTTTACGTCCCTGGCGTTCATTCC
GTCCTCGATTTTTCACTTCCTTATCTGTCGCTTCAAACACCTCCAGACATTTCTGAAGCTCCTCAATCTCGTGCCTCTGCTTTCCACCATCCGCAGAGCA
TCGCGCAGCATCTCCGACGTCTCCGAGTCGTCTTCACTGGCTCGTTTCCGCCGTCGCGAGAGATGATGTCTTGGCGACTGCAAGATCACCATCGACGAAG
CAGACGTCGACGACGCCGAGCTGGAGGACCTTGACAGTCTCCTGGCTAGAGCGAGCGCCGCCTTGCCGTCCATACTGTTCTTCCTTGTGGCCTCCACATT
GCCCGCAGCTTGTCGCAGCTGCTCGATCCATTCCATCCGCGCCTCGTGGGACGGCGCGCGGAAGAGCAGCACGCGACCACTGCAGGACGTGACTTTCCAG
CACGGGCCGCAGTCGTCCCCGCAGTTGGCCGCGTCTCCGTGGCGGAAGATGCGGTCCACGGCCTTGATATCGGCGTCCACGAGCGGCACAACGGCGCGCG
GCCAGTCGCCCAGGTGGGCGTAGTAGTAGAGCGCGTGCGCGTGGATGCCTACGAAGAAGGGCTCCCACGGCGACTCGAAGCGCCGGCCTTTCTTGTGCAA
AATGCGCAGCGTCGTGCGCTGCTCCAGCTCCAGCCCCGTGAGCAGCAGCTCCGGGCACTTGACGAGCTCCGGTCGCGGCGAGGAGCTCGGGGTCTCTTCC
TCCTCGATGGGGATCTGCACCGTGAGCCGCGAGACGCGGCTGCCGCTCGGGTCGAACACCGACGAGCGCATGATGAGGGAGTGCGTGCGTCGAGCGCCAA
GTGATGGCGTCTTCGATGCCTCACGCCGGAGAGGAATGGCAGAGTGAGGAAGGGCAACGGCATGTCCGGTGAATAGGGCGGCGAACCGGTGCAGTGGGCA
GACGGGGCGAGGGGTAATGCACCCCGAATTAGGAGTCCGACACCCGCATTTAGATATGAACGCCCGGCTCTGCGCTGGAGTCGTCGGTTCGTATCAGACA
CAGCAGGGCAACATGGCGAAAGAGAGACGACGACGAGCTGCCTGCCCGCGGCATTTGCTTGCCTGGAAATCGTCGGCAGAGCTGCTGCTCCACGCGGGAT
AGAATTGCGGAGGTTTGCTTGTCGAGCGGTTCCCTAGATGCGAGCAGATCACCGCGTAGGTTGAAATATCGCGCTCGTAGTCGCTGGCTTGTCCTCGCGG
CGTCGGCGTTCCAATGCGGGCGGCCATAGAAGCCCCGGCGTCTTCGCCGACGCTTTACTGCGAAGCCCACAACTCGGTCGTGGGCCACAATCACGAGCAG
CGTCGCCGCCGTCGCTGACTCTCCGGCTTTTTTATTTGAGCTCGTTCAGCCCGATCTTTTGGGCGTGCGTCACGCACTGCGGGGGGAAACAAGTACCAGT
ACTTATCTATACAAGTCTTCGCGGTGCGAGTCGCATCTCGTGCCTCACGCATTTCAGCGAGGCGGCCTTTCACATCCCAAGCATTTCGCGAGCCTTTCCA
ACGCAGCCTCGAAAAAAACTTGGACGAAAGCCAGCCAGCCAGTGCAACGGAGCTCCTTGCCTGTCAGGTTCAGTAGAGGAGGATGCCGCGTTTTGATATT
CGCCAAGCGAGTCTCGGTGGAGTCCTCAACAAACTCGGCTGGGCGGTGATTACCAGCAAAAAGCACCCGTCGAACGACTCAATGCATCAATCAACGGCAG
CGGCCTCGATCTCTACTGAGCTACTCTCTCCACAGAGAGCGTGACGCCATTCCATCCAGCACAAACAGCCTCATGGGTAGCAGCTGCAGCCAGCGAAATG
CAAGGCATCAAGGCCTCCAGCTATTCATCGAGCCAAGTGCTCGACTGCTCGTCTACAAGACGTAGCACGAGAAGTTGCTGCGAAATTGATTCAGCCAATG
GGGTGCGTGCATTCGAATTTTGACCAATCGCCAAAACTGCGTAAATTTCTGTGCGCACTTTGTCTCGTACTGCGAGCGCGGTCCGGTTCGGCGATGCGGT
TCGAGAATCGGGCATACAATCAGCAAGTGCTTTGCGGGACCGGTCCCAAGATGAAGCGGAAATGCTGTGCGATTTATTTTCTGTGGCCTCCGAGCGCTTG
GCTACCAGAGCTCGTCCATTCGGCCCTTTGCCCAGATCAGCAGCATCTTACTCCCGTCTCGCCCGGCAGCCATGGTACGTTTCTCACGAGCCTCTTCTCG
AGATGGCTGCAGCCCTGCGCGACACGACGCGACGCGGGGGAACCGGGCGACTAAAAGGGGAGACGGCGGACAGCCCGCCAGCTGCAGCGTCCAGGTGGAA
ATCAGTGCGATCTTTAGCCCGTGTGGACGCTCGCAATGACGGCGCCTTCCCACTGTCCCCTGTCTTCACGGAGATCCTCCTAGTCGCTCCTCCCCGCTGT
CCTGCGTGTTCTGTGGCTGCGTTGATTCACATGATACAGACAGACGATTGACTGGATGGTTGGCGCTGTGTGCACAGGCCAGCAAGTACCAGAACATCTT
CGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGGCCACGCCTCCCCCGTCGGCCCCCGTCGCTCTGAACAAGCCCGCCGCTGGA
AACAAGAAGACTGCCAACAAGTCGGCCCCCGTCGGCGACAAGAAGGAGTCGCGTGGACCGCGTGAGGGTGGCCGTGCCCCGCGTGAGCGCGGCGAGCGTG
GTGGCCGTGGCAACCGTGGACCTCGTCGCGAGTTTGAGCGTCGCAGCGGCACAGGCCGTGGAAAGGAGACCAGCAAGCAGGGCGGTGGTGCCCGCAACTG
GGGCAACAAGGCTGATCCCGCCGAGCAGTTGGCTGAGGCCGCTGCCCAGGACAGCGCCAAGCCCGCCTCGGATGAGGAGGCCACTGAGGAGGTCGCCGCC
GTGGAAGAGGAAGAGGAGGAGGTGCAGCTCACCCTCGACGAGTACCTTGCGAAGCAGAAGGAGTCGCGCTCGGGCGACCTCTTCGCTGACGTGGAGGTGC
GCCAGGTGGCCAACGAGTTCTCGAGCGCCGTGCAGATCACCAAGGACGGCAAGACCCCGGACTTCATGGACTCGCAGTACGAGAAGGTCTACAGCAAGAA
GACCTCTGGCCGCAAGAAACAGCTCATCACCGACGTGGGCTTCCGCACGGAGAAGCCGGAGCGCTTTACGCGCGAATTCGACTCGTCGCGTGGCGGCCGT
GGTCGTGGCGGCCGTGGTGGTGCTCGTGGCAACGGCCGCACCGGTGGCCGTGGCGGCCGTGGCTCCAACGTCCCGAACGTGACGGACATGAGCGCCTTCC
CCAGCCTCGGCTAGGGATCGCATCGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCAGCGACATGATGAGTGAGATCTTCCACAAGAGGGCTTCTCGAG
GACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCGACGAAAGATCCACCGGATAGGGCCTCTGCGCGGCTGGTGTCTGCCTGACTGTGTGTACCCTCC
TGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCCTTGGTATGTCTATTATTCAATGCAGCAGGCTGGG
CTTTATGCGAACGAAAATACCGTTTTATCATCCGTGGCCTTTGTTTTACTTTGTTGTTGTTGTTGCGCGTATCTTCACGAACACGTTGCCGCTTATCTGC
AGGACGTTACAGTGACTGATGTTCAGCAATACGACGTGCCTTGACGCTGTCTGGTAGTACTACGATGGCGCCGTGAGCCGCCCAATAAAAAGGTGTTTGC
CGTTGGTTGTCAGTTTCCCACGCTTGAACACCCCAGCCTCACACGGGGGTCGTGCTTCCACGATGAGCTCGCTTCCTTCGTCATCTTCATCATGTTCCCG
AGAGAAAATGCCGCGGCCGGAGGGAAACCCATGAATCCACGTACCAATGAACTTCCGTCCGTCAGGGGAAGACCACAATCCATAGCCGTGGACCTCGCCC
ATGCACCATTCGCCGTCGTAGACTTCCCCCGAGGCAAACGTCAGCGCGCCAAACCCATTTCGCTCGCCAGCTTTATACTCGCCAGCGTACACGCTCCCGC
ACTGGAAATGGTGCACGCCCTGACCGCTCAGCTCCCCGTCATTCCACATGCCGTGCAGGGAGCCTCCTGAAAAAATGTACACACCTTTGCCATGCATTAA
CCCTTGGTGCCACGTGCCTTCGTGCGAGTCTCCACCCACCCACTCATACTTGCCAAACCCTTCGCGCTCACCCTTCACAAAGTACCCCTCGTACTTGTCC
CCCGAGCTGAACACCTTGGTTCCCCACCCGCTCACCTGGTTGTGTCTCCAAGTGCCGTCAACCATTTCACCTGAGGACAGGAGCTTTTTGCCTTTGCCAT
GCATATCCCCCTTCTTCCACTCGCCTAAACGAGCAGCACAGCGCACACACGGCTCAAAGGGTGGACACACGGACATGGTGTAGATTTTCCTTCTCACCAC
GATAGCTGTCTCCATTCTTCCAGAAGAAGGTGCCGTTTCCATGCATCTACCATAAGTCTCCCATCAGCACCCGAATAAAAGTGAGCAAGTACTAAAACCT
TTTAAGTACCTTGCCTACTCGCCAATTGCCGACGTACTTGTCCCCATTAGCCCACAGGTACGTCCCAGTTCCGTGGCGGTGGTTCTTCCGATACATGCCT
TCATGGCAGTCTCCAGTACCTGCAAAGGTTTGCATGCCGAACCTGCACCAAAGGCCAACAAAACATTATTAGCAGACCAACGCGTTGTCCACCCGTCAGT
GACGCTCGCACCCTTCGAAGTCTCCGTGCACCCAGCCACCTTCAAAAATGTGCCCGGATCCCAATATGTGGACACCAGTGCCGTGTCGCCTCTCCTCGTC
ATCTACGCTGCCTTCGTAGCGACTGCCGTCCGCGTACTGGACCACGACGGCCCCTCGCGGCTTCTTCCGGCGGATCGAGAGAATCTCCGCGTTGCGATCG
CCCGAGGAGGCAGCAGACGCGTCGTCCGCCTCGAACTGCGGCGTTGGTTCCTGCTTCTGCACGCGCCCGGCGGCTGTCGGGTCGGCTCGGTACGCACCGA
AGCGGGACCCGCGGCGTCGACCCCGGTTCCCCATCGGCAGTCGCGGATCAAAAGCAGCAGTGCGCAATGTTCGATCCGTCGCTGTACTACACTGTGAGTG
ATGGTCTCTGACCAATTTGATCCAAATACAGGACTAAATACGGATACTGAAATCAAGTCGCGACCGACGGACTTGATCCGCCACCTTATCAATATGTTTG
TGGCACTCCGCGCGTTCCTGGCGCTCGTGTGGTGGCACCTGTGCCACTTCCTAGCCTACAACCTGCACGTACGCGGCCTCAAACCGTCCAGCCAGTTCTT
CCACAAGGTCGTGATCATTGGCGACGACTTTGCAGCAGGCATCGGAGACTACGTCACGATTGGCGGCGCTGGCGGCGGCATTGCCGAATACCTAAAGAAG
GTCGTCTCGCATGACGACAAGGCAAGTGAAGCGCTAACGTCGAGATAAACTGCTGTAATTGCAGCGCCACGATGGCCCTTGTTAGGTCGCTTTGCAGCGT
GCTCGCAAGCTTACTCACAAGATACTTTCTGTGCTAACCGCAGGTTCGTCACAACTGGGTCATCGTCAACGCCGGGGTACCTGGAACCACAACGGCCGAC
TGGCTCATGTCATCGCCGAAGAAGGTGCATCGATAGTAGCTATCGGAGACTTGTGGCCTGACTGACAAAACGAAATGCTGCACACGAGTTAGTACTTCAA
GAACGTCTTTACCTCGAGAGCCATGGCGGACGCGTCAATCGTGATCATCGTTCTCGGATCTGTGGAGATCAAGTGAGAAGCGTGGAGGCGCTATTGCATT
GCGCAGCGAAGCGCCATTTTTCTAACATTATTGTGGTTGCTGCTGGCACCTGGATAGAAACCCAGCTGCCGCTGGACACGAGATGAAGCGCCACCTCATG
GAGATCTGTGATACTTTGCGTAAGAAGGGCAAGCAGGTGTGCCTGGCCACTGTTGCGAGCCCCGACCCAACTGCTGATGAAACGGACACCGCCAGCTCGA
CCCTCAACACGGCACTGGAGCAATTTTGCAAGAGGTACGGCGAGGTTCGAATCCATCGACTTACTCTCGCGAGCAGGGATGAGCAAGTGTGGTTGCTAGG
AAGTGGTCAACTAACTCTCACGCATATGTGATGGATTGGACAGCACATCAACGGAAGAGACGCCCGTTATCCTGGGCCCACGCCTTGACACGTATGCATT
CCGTCGCGAAAGCGCGCTTTCGTTCGACAAGTACCACTTCAACTCTCAGGTACGATAGCTTGCAGCAAGCCTTCAACCTGCAGTCATTCCATTCCAAGCT
GCCGTTCTAAAGCGAGATCTCACTCACCACCCGCCTCTCTGCACCTCGTAGTCGTACCGACAGCTAGCTCGCAACACGGCGGATTTCTTGGTCCCCATGA
TGACGGCACAGGAATGGACTACTTGGAAGGAGCAGCTCAGCCATGTCACCTACGACAAGGCCTTGTACGATTAGAACTTTCGTCATGCACGCCGTTCGGC
TGCCGACTCGTTTATCGGCTTTGCAAAATATGCCATACGCCAGCAGACAGCTTCGGAGGTATCCGCGCTTGCATCCTCCTAGCTGGAGCCAACTGGCTGA
CTGGCTGACTGCTTGCGCTCGCGTCCGTCCACCATCCAGAAAAGATAAACATTAACACCACAGGAAACACGCGGGCTTTCTTTTTCTTTCGTTTTGGGTA
TTGCCTGGTCTCGCCGCCTTCGCTCTCGCGACGTTTATGTGAGCTTCTTGTTCGCTTCACACGCGGCCTTCTCAATGTGTGCATCTCCATCGCTTCCATG
CCATTGATCTACATGTCCACGTCTGTCGTCAATGACTACAACTCGTCATCTCCTTCTCAAGACTCCATAGCAGCGTCCGGGGCCGGCTCGCCCTCCGTCT
TGGTGGTGGTGGCGGTGGCTTGCGTCGGCTTGGCAGCCCAGTAGTCCTCCATCTGACGGTCCAATTGGGCAGCCTTGGGGTCGGGGCCCTTGCCGGCTTC
GTGCCAGTACTCGTCCATTTCCATGTCGAGGTCTTCTCCGCTCTGAGGCTTGGCGT