Description :
From Genome Similarity Track
Location :
contig_38:364327- 394281
Transcript NameFunction/comments
g8781.t1hypothetical protein
g8782.t1hypothetical protein
g8783.t1XP_009515449.1 hypothetical protein PHYSODRAFT_477034 [Phytophthora sojae
g8784.t1XP_008911542.1 GTP-binding protein TypA/BipA [Phytophthora parasitica INRA-310
g8785.t1XP_009515447.1 putative glycosyl transferase family 48 protein [Phytophthora sojae
g8786.t1OWZ19532.1 hypothetical protein PHMEG_0006216 [Phytophthora megakarya
g8787.t1RAW41919.1 hypothetical protein PC110_g1911 [Phytophthora cactorum
g8788.t1hypothetical protein
g8789.t1hypothetical protein
g8790.t1hypothetical protein

Sequence
29954 bases(100 bases per row)
GAATCGCGAGAGATTGTTTCTGACGCTGAAAAATCGCCCACAGTCGCTCTCTCAGCTACTGCACCTCGACCCGATCAGCTCCGGTGGATCATTCAGCAAC
AGCAGCATACATGTATATCGTATCTCAACAGCAGTCAAATGTCCAGCAGCAGGCGCAGGTCAATTATCAGAAGCGACTCAGTCACTACCGGTAGCGTTTC
CTGTTACTACAGTAGACGGCGACAGACTTTCGCGCTGCTGCAGCCCGATCTATGAATGCTTTACGTCCCTAGGCAACATGCTTGGCTTCATGTACCAACG
TAATTCACTGCGCCGGCTCTTGAGTCGCAGCTAGCGCACCTCAGCCTTCCCGAAGACGCACAGGTATCACTGAGCGTAGCCAGCAACAGGCGGTGGCTAA
GTATGCTGACGAAAGAAAACGTGATGAAGCTCTTGGATTGGGAAAACGGAAAGTCCCTGCTAAGGGTGTCGTGTCGAAGAATAAAAAAACATGCTACTCC
GCGCTTTTAGAGCCGATACGCATGACCTAAAGATTCCTTTATAGTTTCTTTTGGGAGTTTACTTGCAGAGGAACATCATAGATCCGACCGCAAACTTTGT
CCGACAGAAATCAGCTTCAAAGAAAAAAGCGTGACCCACGACTTCGCATGTTGTTCCCTGAAAACGCCAACGTAGACTGCGAACAGTTAGATGAGCAGCA
TTTCACTGGAGCTGAAAGTGCTCTAGCGTGCACGAGCACTTGGTGAACCAAGCATTTGGAGCAGCCTACGTTGATCACGACACAAACATTAACTATCGGA
TGGCCCAAGCGGATTCTGGTTAGTTTTATAAATCATCTACATCAGTACAAAACTCCCTGTTTGCTTCATCCAGCATCTAACACACACGTGCTAAGGTGAA
ACCAAGTGATTTTGCACAATAATTATCAATCGGTATTACTTCGTACTTCAGTATCCTATAGCGATATGATTTCCAAAAAGCGGGGTCAATGAGTTTTAAC
CTTGGTTGGCGACTTTCAAAGCAAAATTGGCTTGAGTGACGAATTGGATCAAATATACATGTAGGAGTGCGTAAGATGGTATGGTTGTCAATTTCTAAAC
AAATACAAACCGTAGCGACAAGTTGTTGTAGCTGCAGTAGTTGAAGAAGATATGTTGATGTGCCAGCTTCACGTCAATCGGTGGTCAAAATGCATCTCGA
AAGTTGACGTCAGGAAAAGCACTGTTCAAAATGGGCTTGACTGAAGCCTGCCTTGGTAGCCCAGTTCGTTGATCACTGCTTCGTAGTACTTAACTATTTC
AAAAGTACGTTACAACTCTGTGTGACCGAACAATTTAGGTGAGTCAACACTTGATAATTCATCAAACATGCTGCAGTGTTGACGAGGCCAAGTTCGAGTC
GCAGATCACAAAATGGTCATTGGTGTTGATAGAACACTCCCTTACACACGCCTTGATATATTGTGGAAGGTATCGTGTTGTGCGAATGCAACCGAGCAAT
ACACTGCAAAGAGCATTCGCTACTGAGTTATTATTGGAGGAGTTGAGCATCTGAACTTTCGTCGTTCTCGAGTCTTGCTTGCTGGCTGTTGTTTCTTTCA
GATCGATCTATGCAGGCCTAGATAGTGGCATGATGCCCAGTCCAAGCATACAGTTAAACAGTATCCGCGATCTGGTCCGCCTCGCTGGACAAGAAACCCA
GCTCGTCCTCTTCGCGGATGGAGGGGCAGTCGCGCAAAATAGCGTGCGAAATAGCCAGAGCTCCGCTGCATTTATAGTAAAGCACAATATTTAGCAAGCT
GACCACATCCGCAGTCCTAGAAATCGCTAGCACTTACCTGGCCGAGCAGATCGTGAACAGGATGGATCCTCCAAACACGACAATCACAGCGGCGCTCACT
GCACATGCAGTCGCAAAGCATACGCGTTAGCACATTTCACGCTAGCTACTGAAGAATAGTGCACTAACGTACCACCGAGCATACCGAGCTTCCGCTGGTC
GGGTGTAACCGTGCGCCCCATAATCTTCGTCGGGTTCTCGGGCGACTCATTTGCCGTCGCGCTCGACATGTAAAGCCAAAAGCCTCCGAGGCAGATGAGC
ACAAAGAGGAAGAACGGGTTCAGCAGGCTGCACCAAAAGTACAACAGTCAGCAACGCGTCCTCTCATCTCGCTGGCGACGCAATGCACGGCGTCGACGTA
CATGGTGACGACGCCCACCAGCGCCGCGGAGATGGCGTAGTTGGCGCTGAAGAACAGCGCGTTCTTGCGGCACCGCGAGGCCAGCACATCGCGGCCAGGC
ACATTAAACGGCTTCTCTTCGCCTGGTAGGTCGATCAGCCACAGCATACCAGTTAGCATTGATAGAAAGGGACTAGGATGGAGGAGAGCGGGGAACCGCA
CCGAGTCCGAAGAACTGGGAGATGCCGCGCACGTTGCGGATATCGACGGCCTTGACGAGCTGGTTTCTGATCTTCTGCAGCGCGTGCTGCGGCACCTCAA
TGGTGATGGAGCCCTGGGGCTCGTCGGACGCGACCTTCATAGCGCTCATGGCAACGGCGGTGCTTGTCTGGTCGTCGAGGGAAAGAGAAGTGGCTTGGGC
ACAGAGAAACTGTTGGCAGGCTCCGGTTGGCCAGAATAGCACACAACTAGCGAATCAAAAATAGGCTGAATTGGACCAATCGTTGGCCACCTAAGATCTG
TCCCTGGAGTGATGGTCACGCTTCAACTTGCATTCCGCACTCGCTCAATCACCAAGATGCAGACGCGCCGCCAGAGCCTCAAGGCGCCGATGAAGAAGAC
CTACGAGCTGGACGACTCGCCAGAAGAGGACAGTGAGTGCGGATGCGCCTGCGCTCGCAGCTTCGACCGACCTCGGCTGGCTGATGGGCAGCTGCAAGAA
TAGCCGGCGTATACATGGGTCTTATACTAACGTCACGCCATGTCCAGGCTGCTCTTATGATGACAAGGTGGAGCTTGCAGCTAGGAATAGCTGAGTAAAC
ACGGTTGACGTGCTTGCTTTTGTGCAGGAGAACGCGGTGAATGCAGCGATCCCAGGACGAAACAGCAAGAGGAAGGGCGATTTGGAGTCTCGCTCCGGTC
GTGGAGGCCTGTTAAAGCGACAGAAGACAGAGAATACTGCGAACCAAGAATCACCACCAATATTCGCCTTCAAGACGGCGAAGACCTCGTTTCGCAAAAG
GAAGGCGCTCAAGCTCCAGAAGCAGCTAGAAGATGAGGAGAAGAACAAGAAGCGGATCGACGACTTGGTTGCGTACTTCAAGAACTTGGACGAGCAAAAG
CTGGAAAGAGCTTGAGATTGGTTGCGGTGAGCTCACTCTTTTTTGTAATGCCAAAGTGAGTTGCTGAGCGATAACATCGCTCATGCCGACTGGGCAGTCG
CTAGCGCAAGAAGCTGATCGCAATAGCGAGGACTTTGGTGACGAGTCCGATTCTCTTGCGCCTTCTTCGCCAGCCGGGGAGCGTCGATCGCTACCGTTTC
CTTCAGAACATTGAAGACGGCCTCCTGCGCGATAACCAACCAACTGAAGAATTAGTACACCTCTACAACTAAAAGAATCGTAAGGCGATTCAAGTTACGT
TGTTGTGCGTCCTTGCTTACCTGGATGTCGGGCTCAGAATCGTCTAGGTGACAAAAAGGCAGTCCAACGTGTAATCGATGATTGTTCCTTGGAAATGCTC
TATCGGCGCAGCTTTCAAAAAGGTGGTAAACGTCTGACACGCCGCTTTTCGCACAGTGTCATTGCTGTCATCGAGGCGCTTCAGAATCTCGGCGTAGAGT
TGATGAACTGGTTCCTCTGTAGACAACAATCACAATAGCTGTTCGTGAGAAATATGCTCCCCCCTTCTGAGAAATAGACGTGCTTCATACCCCCCAAGCA
CCCAGGCAATGCTACGAATAGATATTGCAGCGCAAGGCAGACCAGTTGGCGAGTCTTGGCATCGCTGTCATCCATCGAGGATTTAAGCACAGGCAGCATC
TACGATGATAGCAACAGCGCAGGTATTAGCACAAGCACTAACAATCAGAGAGGGTACTACCAATACACAAGCATTTACCTGAGGTGCAGTCTCAAACAAG
CACGGCTGGTCGGCAATGCCGTGGCGAAGCAGCGTGTATGCACAAGCAACAGCTACTTTTCTGATGGGTGCAAGTAACAAGTCCAAGCATCAGTACTACA
GGAAGATAACCTTACTCAAAGCATTTATCACTCACCTAATAGTTGCAGCAACACGCCCTCCACGCCACACGATGTTCGGAATGATAGTTTTCTGGAGCAA
AGCAACACTAAATGGCTTAAAGGCCTGGAAAAGTAGTAAACACAAGTCCATTAGACACGACATGAGCCATGAGCAAAAGCTACGCCGAGTGATAGCGTAC
CTGGCTGATAGTATCCGTCCCTAGCATCGTCTCCAATAAAGCAAGGAAAGCGAGCCGGACATCCGCATCTTGAACTGGGTCGAGGTGCACCAAGAAGACG
GGCACAATTTTCTTCAAGTTTACACCGCATGCCTAAACGAAGCAAACCAAAACGACAAGTTAAAATGGGCTTCTAGCAGAGATACTAGAGCATAGAACGT
ATTATACCACTCCTCCACGTCGACAAAGCGAGTCGAACAGTACGCAACTCGGGTCGCTTTTTTGCCAACTGTTTGCTGCTTCAGTGGGAAGCCTCATAGT
ATCCAGAAGCTTGCCCATGTAGCGTGCATAAAGTACCTAAAGTCAACCGAAGCCATGCAAATTAGAGAGTACTTCACCCAAACGAATAAAATGAGACTAA
CCTCAATAGGCTGCTCAATCTTGACAGCCAGATCCAACATAGCTTCGCTTGCCTAATTCCATTCCAACGACAGCGTTAGCACCTTCGCGCATTTCAGACC
CAGCAATACGTCGTGCAGGTAGTATACCGTCTCATAGGCAACTGATGACTCTGGTGACGCAGCGAGGAGGTGACTCAGCACCCAAAACAGTCGGAAGCAG
ATCTCATCTTTTTGCGAGAGCAGCGGTGCAGCAGTCTTGATAATACTCGCGACAACGCCAGCCAATTGATCTTGCAGGTCTGATACTTCAGACTCGCGCA
GACCAGCGTCACACAATGCCTCGGTGATCAGCTAAGCGGTGATCAGCACAATGATAAGAGCGGTTAGTTATAGTCTACGAAAGTTCTTACTGATGGCAAT
CCGTGCGTACCTCCAGGTGAGCTCCAATCGTCTTTGTTGTCATGCCTTCGATACTCATACCCAGCAGGACTAAGCCATTCGTGCGGTGCTGCGCGGTATC
CTGGCCGGCCAGCCTACCTGCCACCATTGGCAGCAAAGAAGCCAAAATCATTTGGGCATCAGCGTAAAACCCGACAACACCTGAGCAAGCCTTCACACTG
TTGAAGACGGGTTCCTCGTCGTCACGGCACGTCTTGCCTAACGCCGAGAAAACCTTGTCGAGGAATGGGTTCACGTTCTGCTCTAGCAACACCAGGTACG
CACTGAGAACTTGTGTGTAGCGTTCACGCACTTGCACAGTCCAATCCCCCGTTTTCTCGAGAAGAAGCGGCAACACCTGCGCTCGAATAGTCACTGCGAG
TTTCCGAGCTCCAAGTGGTGGGCGAGTCTCAAAGAAAAGAGGTGGTGTGTTCTTCGCTGAGTCCATATCCACCTCCATCGGCTCTACATCGTCCGCCTTA
ACATTTCATCTTCATCCCGAGCCTCCCAGATTACTGAAAGTTCATTCAGTTTAGCGAGAGATAGCTGCCGAACCTCGGGAGCTTCATCGATGATTCCTGC
CAGAAAATGGGGAAGATGGACGCTTCATACTGCTGAATCTGCTGGATCTGGGCTAGCCACGCAGCCAGCATGATCACTAGTTGCTTCCTCACGGACGGGG
CATGGTCAAATACAACCTTCTCAACAGCTGGGAGAAGCACCTCCTTGATGAGCTCCGGTAAAGCCTCCGAGCCACAGGGAACCGCAGCTTCCAACGCCTG
CAATGCGCATACGCGCACGCGGCTGTGCTGGTGGCCAAGATTCACAACCATAGGTCGCACAATAGCGCCAATCTGCAAGGCCACGTCGCTCTTCCAAGTC
GTCGAAATCAAGATGACGCACTCTGCTGCCATCTTCTTGGCGTCCGGGAACGGGTCCACCGCCGTCTTGCCCAATGCGTTGGCCAGCTCCGAAATAACGT
CACGCAGTGACGTCGCCGATACTGTCACTGCTGCAAACTGCTTCAGGAATGCGTGCAGTAGCTGCAGAACGAGCAGGCGGATCTCCTCCGTCGGCTCCGG
GTACGGCAGCTTGCCGAGACGCGCGCTGGACAAAGCCACCAGCTCCTTCAGAGTCGCGTCCGACGGCTCCAGCGCCCCGTTCTCGCACAGAACAGTAGCG
ATGTGAGCGCTCGCTCGCGGCATTTCTCGACGGCATCGCTTTCGGCGCATTGCAGCAGCGGGCGCTGCAGGTTGGCTACGCACAGAGCGCGCAGCACTCC
AGCGGACACCCGCGACGCCTCATTCTGCAGTGCGCGGTACAGTTTGTCCGCGGCACGGCGGCGCACGCTTCGATCCGGGTCTGCCAGGCAGTTGACGTCA
CGCTGCATCTTCATGGACAGCATGTTGTACGCGGCCTCATCCTCCGGAGACAGCGCCATGGCTTGCAAGGCAGCGGCGTCGGATCCAAAATGACCCGCCA
CTCAAGTCGGCCATACAAAAGCCAAGTGATGTAAGATAGGGCAACTTACGTAAGAACTTTATGTTGCAGCAATGAGGTGGACAGCTTTGTCGGCCCTGAA
CCGGCAAAGAGATACCATGTACACTGTTAGTTGCTCTATGTGTTTCTGCTGAAACTCATCTACTGTTTGTTGCCTCTATATGAATACGAATTGCTCAGAT
GCTTCGGACGCTGATTGTAAAATCGCCAGGCTTTGCTGAATCGAAGACATGGCTCACTTCTTCTTGCCCTGCACGCGTTTGCGGCCGTTGGCGGTGAGCT
CGCGCTTTCGCATGCGGATCTTGGTCGGGGACACATCGATCATCTCGTCCTCGCCAATGTAGGTCACAACATCTTCCAGGGACATCACGCGGATCGGAGA
CAGCTTGACGTTCTCGTCCGTGCCGGCAGCACGCATGTTGGTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGCTGTGCTCACCC
ACGATCATACCCTCATACACCTCGTCACCAGGCTTCACGAACATCTCTCCGCGGTCTTCAAGCGTGTTCAACGCGTAAGCCTGTTTCCAGCAAGCCATAT
TGAGTAAATAGGATTGGGGGCACGAACGATCGTACATTTAAGCTATCATCTTACCGTGCACATGCCTCCAGACGAGGAGATAAGCTTGCCCTTCGACGGA
GGAGTAGCCGAGCCTTGGAACGGCGAGTAGCCGTGGAAAATCGAGTTCAGAATTCCACTTCCGCGAGTGTCAGTCTTGATCTACACATAGGAAACATGAT
CCAGAGTAAGTCCTTATTCGAGAAAAGTGCTCGGATTCAACGCATTTACGCACCTCACTGCGGTAGCCCATGAGACAGCGACTGGGAATCTTGAACTGGA
GGCGCACTTTGTCGTGCATCTCCTTGAACTCGATGATCTCACCACCACGGGTCGCCAGCTTGTCAATAACCGTGCCAGAGAAATCGGAGTCGACATCGAT
CGTCACTTCTTCGATAGGCTCCAACTTCTGGTTGGTCTCCGGGTCCGTCTGGAAGAGCACCTGGGGGGCTGAGACAGACATCTCAAAGCCCTCACGACGC
ATTTCTTCAATCAGAATAGCAAGCTGAAGCTCACCACGGCCGTGCACATCGAAGGCCTCCGACGATTTACTTTGAGAAATGGAGATAGCAACGTTGTTCT
GAAGACATCAATACACAATCATTCATCAGTGAATCACTCAGCTCAACAAAAAAGTAAGAAAAGCAAGATCCCACTGACCTCGCATTCGCGCTCAAGGCGC
TGCTTGATATGAGAAGATGTGAGGAACTCCATCCTTGCCTGCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGCGGGTCCAGCTGCGGA
GAGGGAATCGGCTCCGTCACGGCCACGTCAGCGATGGTGTCGGACACATACGCGTTGACACCAGCAATGGTGATAATGTCACCTGTTACAACGAGTTATG
CACAAAACATGAAGTATTAGCATGCAAACGCCTTCAAGCATAAAAGAGTGATGCTCTCAAACATACCAGCGGTAGCCGACGTGATCTCCGACTTCGAAAC
ACCACGGGTCACGAACATCTTAGTCACTCTGCCAGTCTCAAGCTTCTTGCTCTCGCGGTTCATCACTTGAATCAAGTCGCCAATCTAGTCAATGGCACAG
TGAAAAAGCGCGGCACATTCAAAAGTCAGTACGAAGTGCAAGAGCATCATCTAGAACGAGCCAAGCCCACCTTGACAGTTCCGGCGTGTACGCGGCCTGT
CGCCAGACGGCCGACGTACGGGTCGTGTCCGATCATTGTGACGGCCATCGCAAACGGTTTGTCGGCGGTAGCTTCTGGAGCAGGCACGTAGCGAGTGATC
TCGTCCAGCAACGGCAGCATGCTGTCACGCGCCTCACCGTTGTCCAGGTCGTGCACGGCCCAGCCCTGTTTCGCTGACGCATACAGCACAGGAAACTCCA
GCTGGTCGTCGTCGGCGTCAAGCGCCACAAACATGTCGAAGAGCTCGTTCTCCACAGATCCATCCAGACGGCTGGTGTCGCGGTCCACCTTGTTGACAAC
GACGAGTGGCTTCAGTCCGCGGTGCAGCGCCTTGGTCAGGACAAACTTGGTCTGCGACATGGGGCCCTCCGTGGCATCCACGACCAGCACCACGCCGTCC
ACCATACTCAGGATGCGCTCCACTTCGCCGCCAAAGTCGGCGTGACCGGGCGTGTCCACGATGTTGAGCACGTGGCCGTTGTACTCGACGCGCGTGCACT
TGGACATGATGGTGATGCCGCGCTCGCGCTCCAGGTCAATGGAGTCCATGACACGCTCCTCGGAGAGTGTGTTGCCGCCGTGCTTGAGCAACTGGTCCAC
CAGCGTGGTCTTGCCGTGGTCAACGTGCGCCACGATGGCCACGTTGCGGATGTTCTCAGCCGTGACGGCCGAATAGTCGGTGGAGAAGGCGCACGCCAGC
GTGGGCGCGCTGCGCTGCAGTATCGAGCGCTGGCCCGAGCGCGCGCGCGCCAGGGCAGGCAGGCAGGACCGACGGAGCCACATGTCGAGCAGGTGCAAGC
GATTGATACACGAGGTCGGGTGATGTGCGTGTGTGGTGCAGAGGCGTCAGCGACCAGGTGATGTGGACCACGTCACAGTAGTGTGCTACACGCCATTTCG
GTGGTGCAGACCTGGTACTCTGTACCATCGAATGGATTTGTTTCGCATCAGGCTGCTTGGGGAAACTGAAGCTGCCTCACTTCGTCAAACGGACGAAGCG
CGTTTGTCAGCGTGACTCGAAGGGCCTACTAGTACACACTGCATCTGAGCAGGTGATATTACCGTATGCATGCTTGACAAGTCCGTCTTTTTAATAACCT
GCGAAGAAAATCGTCAATTGACGCGACGGTGACGAAATTCGCGGTGACTCGTTCTGTGAGCAACTCTGTAGCAAGAAGCGACGCGAACCACCGACCATTT
ATACCGGTCCTTCGCAGTCCTCTCGTTCCTTTCACGCGGTCGCTGAGTACAGGTGTCTGCCCTTTGTATCTTGCACCAAGGCTCACAACATCGCGAGGCA
CCTTTACTAGACTCATCCGATTTACCGCAGCCTACAATCAGAAAGCTGCAGCCTGCAGTGCAGGCACTGTCACTTGCGACGACTCTGCTTACTTGCCGCC
ACCCGGCGGTCAGGTTGGCCGAGGCAGGACATTGGACGCGCTTACAATCGAGGGAGCTGCGTCGTTCCTTACACTCGAGGGTTCGATTTGGATTAGTGTA
CACCACACCAGGCGTGTCAAATGGCTACCGGTACATGTAATCAGGCGTGTCACGCTGAGCCGAGCCGAGTACGCGGCCGATTCTTGGCCCGCGTTGCACC
ATGTTGGGGCAAGTGCGTGGCGGCGAGTCGCCGCTGTCGAGTTCCGCCTCGATTGAGGAGACTGCAGTCATGGCGAGCTCGTTCTCGCTTCGCCATCGGT
CTGTGGTGCTTGGAAAACATGAGCAGGATGCGGCGCCGCGTCTTTGGAGGCCAGTGGCTTCGCATCCTGCGATTTGAAGGACTAACTGCAACCTGCGGCC
CGATCTCTGCTCAGAGTCTGAGCCGCAAACAGCGGATCAAACACGCTCCCCGATCGTTGAGGCTGTCCATAGAGAACCACACAGACGCAGGGCTGCTGCT
GCTGCCGCGCCCGCGGGCAGTTTGTGAATCAAGCGCGGCCAATCGCGGCGGCGCGGGTATGGATAAATCAGGATTGCCCTCCTCTTCCGCGCTTGACATT
GGTCTCTGCTGCAATGGCAGCCAGCAAAAGCCACTTTGCCGCGACATTCGCGCTGCCAATGCCTTCGCTCGGACCGGTGAAAATTCAGAACTGTTTGCGT
GCGAAGGTCGGGCCGAGGGACCAAACGAAGGGAAGGCGGGGCGGATACATGTGTCCACCCGCCTCGCGGGAGTGCACTACAGGTCGTTTGCTTGGTGCTT
GGTAAATAAGCAGTCCTTGACCAGTGGTCAAGTCCACCGTCAGCTGCAGATACCACCGTCCCCCCCCCCCCCACCTTCTAAATTGTCTAGCGGGCCGGCT
TTGCCTTGTTGTTTGTATTCAGCGAGGCGCAAACCCGCAGTCCCGGCCCGGGTTTGTGCGCAGCCTCTATGCGATCCCAGACGTTTGATGCGGAAGATCT
GTCCGAGCCTTCATTCCGCATTTTGCAGGCCGGCGTTGCCTTTCCTCCTCCTCGAGAGTCCCGAAGAAAGCCTTGTGCGCAATGGGCCGGAGGACCTGCG
CGCTGCTGCTGCTGGCGCTCACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACCCGCCATAACCTCACGGCTCTCCAGAAGCGGTG
GATCGACCCGGACACGGACCCCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAACGCCAGCGAGATGAACGAG
TACACGCTCATCTTCTCGGACGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTCGACATCCGAGATACGACCA
ACATGGGGCAGCACTACTTCCTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGAAGCGCTACCGCGGCACCAA
GTACGTCAGCGGCAGCGTGCAGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGGCAAGTGGGGCATCCCCGGC
ACGTGGCCGGCTATCTGGATCATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGCTTCGATGTCTGCGCCCCCT
TTGTGGAGAAGACCGAGAAGGTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACCCGGAGATGTACGGCTTGAA
CCCGTTCCAGGGTCGTGGTGCCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTCGACGTCGCTGCAGATCCGT
CCTAGTCTGTCTGAGGACATGCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGCGAATTCACGCGTATTAACA
GCGACTACTATGGTGAGGTTGGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACTTGTACCGCCTGGATTGGTC
CCCTGGTCCAGAGGGTTACATCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTGGGTGGGTGATGTCCCTCCT
CGCCAGCTTCCTGTGGAGCCCAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAAGTTCTCCCCGCCGTGCGATGGTCAGATTTGTGACTCGATATGGC
CCTCGAACTTCACGATTGACTATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGCGTATCCTACGAATGAATG
GATCTACTCGCATCCGGTAGACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCAGTGATTAATGCTCTTGTG
GGCTTTTTCATGGCTTTCCGAGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTTTTATGGAGCGATAAGTG
CAAGCGCCCCAGAAGAATTTGCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTCGTGTACCCGATTTCGCT
AGGTGCGATGCTTGGTTTGTATGGTGGCGTAATGATAAGCCAGTTCGTGCCTTTGCTTTCTACGCGGGTGATCACTGCTGTGTTTGTGGGTGTGGGCATC
GCGCTGGGGTGTGCGCCGCAGATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCTATCGATTTCGCTTTGGG
TGAGCGAGGGTGACATTGCCGACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTTTGCTCGGAGCACTGCTT
AGCGATGTATGCGCTTCTTCTCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCCATAACGCGATTAGTGCG
CGCAAAGCTAAATTCCCGCAGGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAAGAACATGACCAACTTCT
TTTCACCGAACAAGCTGCCGCACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGATTCCAACTTGACAACTT
CCGCAACCAGACAGAGCACATCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATTTGGTGTTTTCTAACTAT
AACAAGTGGTGCTCGAAGTTGAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGACGAGATCTCGGTGGACT
TGTGCCTGTTTTTCTTCATCTGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGATGAAGGAGGAGTTTCCGTC
GGTTCGTCACTCCGAACGCGAGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGATGTCGAAGCACGACCAC
GAGGACCGCCACAATTACGATGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGTTCTCGACATGACGTCGC
CGAGCCCTGCCATGATTTACCAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGTGGTTCCAAGAGCGGCAA
TTTCTTCCAGAAACGCAAGAGTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTACCGCTGCGCGCCTTCAAC
CGTATCTTCAATTTCCACGTGATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGACTTGTGCAAAATCACGT
CAAGCACTCTGATCACACCCTTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGAGCGTTTTCGACGGTGCG
TAATGTTTTGCGGGTGCTTTTGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTCTGTGGTGGCAGACGTAC
TACGTCGTCACGGTGATTTTCCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCGACGTACTACGTTTGTTC
CCATTGCCTTTATCCGTGATATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGCGTGGGCTACCAGTTTTT
CTGGGCTTCGCAGCTTTTATGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGTATGCCGACCATGTGGAG
AATAACGTGAGTATGATTACAACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCACGATTTGGAACTCGATCT
GGATGGCTTTCACGGGTACCTTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTTAGCCGTGCTGTGGATGC
GTTCAATGCAAAGGTGATCGCTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCGCTGTTGGCCACGAGGTG
CTAGATCGCGTTGCAGGTGGCGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCCTCTGCTCTCTTTCTCGC
GTCGCAAGCAGACACCAATGGAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCGACAGCATGCGCGCGGA
CGATTTGATCTCGAACAGGGAGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTTCCAACTGGCTGGTTGC
TTCGAAAACTTCACTTCCAGCATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTTCTGGAGATTCTCAGTG
AAAGTCCGATGGTGGAGGAATCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCGTGCCACAGCAACGATGTGAAGTA
CATCACAAGTGTTCTCAACTCATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGCTTTGGCTAGCTTGGTG
TTGTTATTGAAGTCCAACGCCCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCGTACGAATTCCCGCAGC
AGTCGAGCTCGTACCGCCCTGCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTCCTCGTCGCAGTCGTGG
TTCTGGAGTTGCTCGTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCCGAGCGCTCACATCATG
CAGATCCGCGAGCGTGTGCGCACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACGGAGAGCAAGGGTATTT
CGGACCGATTGACATGGATTCTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGTCGTTTGAAAGCCACAC
GGACGTGGTGCTGTCACACCTGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCGTCTGCTGTTCTTCGTG
AACTCGATGTTTATGGATATGCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAGGACGTGCTGTACTCAA
GAAAGGATCTTGAAAGTAAGCAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGAACTTCCTGGAACGAGT
GAAGCCGAAGAAGAACATCTGGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTCGCGTACGGTTCAGGGT
ATGATGTACGGTGAAGCAGCCATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACGAAGTTTACGTACGTCG
TGGCTTGCCAGATTTATGGCCGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGAACCTCCGTGTTGCTTA
CATCGATGAGGTGCGCGTGAACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGTGCATGAGATCTACCGT
GTGCGGCTGCCAGGCAACCCCATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAACTTGCAGACAATTGATA
TGAACCAAGACGGATACCTCGAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGTTCACAATCGTGGGCAT
CCCAGAACACATTTTCACGGGTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCAGCGTACACTGGCGCGG
CCACTGCGCATGCGTCTGCATTACGGCCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCCAGCAAGGGCATCAACC
TCAGTGAAGATATCTTTGCGGGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGGGGCGTGATGTCGGTAT
GCAGCAGATCTACAAATTTGAGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCAGCGACTGGACTTCTTC
AAGCTGCTGTCGTTCTACTACAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTATTGCAACCTGCTACGCG
CTTTGCTTTCACTTGAGGGTGTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCTTCACGACTGCACCGCT
GCTGGCAACGATTTCTGTCGAGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTACTTCCTGTTCCACATC
GGCACGAAGTGGTTCTACTTCGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAGCACTCGTCTTTCGACG
AGCTCTACCGTTTCTGCCAGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTTGGCTTCCAGTACTTAT
CGACGACGTGGTCGCTGTGGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTGACGTGATGGAAGATTT
CCGTTTGTGGTTCAAGTGGATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTACTTCTCAACGCTCCGT
CCGTGGTCCAAGGCGTGCATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATATCACTCGATCCTGACTG
AGTCGACGTGGCTTCCGTTGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGCGTTCCAACGGTGAGAA
TGGACTTGTTCGATTCCTGAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTATGTGGCAGTGTCTGCTG
AGCATGGGATACCTCGCTGCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTACTTTGTGCACGATGCTG
TGCTCGGTTTGGTGTCGTTGAGTCTCATCCTGTTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACAACAATGCGCTAAGCCG
CGGCGTGGTCATCGAGGACATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTCGATCATCATGGAGCAG
CAACGATTCATCAACGTACTGACTGCCAGCGGCAGTGATGCCGACACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCACGCTATGAGCGACAAC
ACGCTTAACGCGGTGTTGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATGTCGGAGGAAGAACGCA
AGGTGGCGCATCGCAAGAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAGCCTTCTCCACGAGCGA
TTTTTCGGCCATTCTGCCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGGCCACACTGCCGTGTAG
ATAGTTAGACGAACTAGTAGGTAGAGCCATTGACGATGGCTTGCTTTGCATTTTGAATGAAAGCTACTGTACCTGTTGATGTTCACACTATTCTTTTGTG
TTGCGCGCATGCATTGCATCCTGGTTACGGTGATGTTATGGAGACTTCGCAACCAAGTGATTTTCGGGGATAAAAGAAATTTCAGTGCAGGGCCCATTCA
AGCAGCAGGAACGTGCCAGGTCATGGCAATAGCAAGTGCATGGAAAAGAAGTGAGACCAGAAGAATCCAAGTCTTCAGCCTGGCCATTTGTCATAGCATT
ATGATGACTACCGATTCTGCAAAACCAATTCCAGCTCTCTCCAATTGGAGAATTCAATATCAGCACAACCCCTGAAGAACAAGTGAACGGAGGATGGATA
TTACTGAAAGAAGAAAAAAAGGCGTTATGGAGTGACAGCGACGAGCATCAGTTTTCCAACCCAAGGCACCAGACACGCCAACGCGGTGAAAATGTTGGAC
AATGGTCTCCGAGTCTTCAAACAAATAGGCGACGCAACAAGGACATATCTCCGAATCGACAGTGTGGATAAAACAATTCAGAAGACCCTCAGTGCAAATC
CAGACACAACTTCAAACACGGGCCACGCCCAGGAACTGGGCTAAGAGCTACAGCGTTTTTTCGATGTACAACGGAGCACACCAGCAAACACGACCTGGAA
GCAATTCGGACACTGGCGAAAACACAATTCTGTCTCCCACAACAAAGAAGAACACCGGATCCGCTGCAGGACTACCTCACCAACTTCACGCAACAAGATT
CAGCGCCGCTACGTCAGACGAATGACGTCTTTTATATTATCAAAAGACTTCTATTGAAAAAAAAACACGTATCAGCAAATAGAAGACCACTTATCATCGC
ATTGCATTCCTGGTTGTGTACAGATAGCACAAATGCTTGATTGTTACTACTGTAGTGGTGGATACGCTACGAAACACATACGTCGTACATGTACTTCGCT
GAAGTACAGTAGGTAAATACACACATAGATTCCATCAGTAGCGTCAGGGCTCTAAGTGCCAGTAGGTAGCAACAGTTTGGCGTCGAGAGCTCAACGATCT
ATCCATGGATAGCGCGAATCACTGGTCGGACTGTTTCCTGGGCTTTTTTCCGAAGCCGAGGAACTTCATGTTGGCGCTCAACTTTTTCGACAACGAGTTT
TTCTGCAGTGGATCAGCGCTGGTCAGCACAGCTGCCTTGAAGTTCTCGGTCACCTCGAGATCGCAGTCGCAAGCCTCTAGCTTCTTTTCGATCTCGTCTA
GGTTCTTCTCCGAGACTGAGCGGATCACTGCCAAATCATCGACAAGCTGCGATGAAGACACGTGGGAGTAGATCTTGCGGCTGTCGGACGCGAAGCACTC
GTCGATATCTTGGCTCGGAGACATGGCCAAATTGGCGAAGAGTTGCTGAATTGCTGGCGAATTCTTCTCAATAAATGGATTGAGCACCCTAGACATAAGT
CAATACAACATACATGTGTTAGAATGCGGCACCAGTAGCAACATTCATCATGTGACACCGAGCGTACTTGAATTGGGGCTCCCGATCTCCAAACTTTACA
CCGGTCGCTGTCTTGAACAGCAACTTCGTAACTAGCACGAGCACGCGCCGAGTCTCCGGTGGAGGAAGCTGCTTTGTGAGCCCGTACAAATGCGGGGTAG
TGATGGCTGGGCACACAAATCGAAGGAAGAGGAATCCTCCGATCACCGACCGAGTCAGCGTAGACGCGTCTTCAGCCTCAACGCCCTCCTTTGACCCATC
AAATCGACTGATGACCTTCGAATTCAGATCGGAGCAAATGTGGAAATACGATGACGGGATCTGCGAGTAAAAACAATAAATTTGGACATTAGAAACTCTC
TTGTACATGCCAACGTCGGAATAAGGTACTTACGCAGTGGGTATTCTTCATGATCGAGTCGATAATGTTCTGGCACGTCTTCATCAGGTTTGCAGCGTTG
GAATATGCCTGAGCTTCGTCCTGGAGTGATTCCTCCTTGTGCGGGTTCAACTCCATCTCGGCAATTTTCAACTTAAATATCTGGTGAATGGGATCTGAGA
GTGCCACACGGATAAATTTCGACCCGATCGCTTTGCTGTACGTGGAAACGAGTCTGCTCGCATAATCATCTGAGCGGAAAAGTGTAGCCACGTTGATGAC
TGAAGCCACCTCGATTTCGATTGCCCAGCGAATAAGGTGGCTAAGGCGGTTGCGACTGCCAAACACGCGGAGAAACGGAGCTAGTAACAGCATCTTGTCT
TCTCGTCCCGCACTCTGGAGAATAGATGCCACCACAGACATAGTGTCTTCGATTACCAGTGAGGGAAGATCTTTCGGGGTCTGTGGCATTGGTGCCCGTA
CTGACACCTCAAATTCCCCGTTCAGAAAATCGCGGGCAGATCTTGCATGGGAAAAAAAATTGCGTATCCTTGGGCTTGCACTGGTACTTGAGCCTGTTGC
AGGCGAGCCCGTTCGTAAAGCACGCTGGTGATGAGCCTCTTCTAGATCGTCCGTTTCCTTTGATGGATCGGTATCAATTCTTTGCCGAATCTCGGCAATA
ATCTCATCGCTGATCACGAGCTGGTCAGGCTGACGTGATTTCTCAGGCTGGGATGACACGATGAAGTCTTTCATGACCTGATGAATCGAGTCAAGAAAGC
CGCTCGCCTCCAAAAACTGACTGTCAGACTGCAGATTACAATACACATACAGTCAGATTCGAAAGCATGCAACGTAAACAGACTACCGAAAGACGAACCG
CATCAAACTCTGACAGGCGTTCAATCTCGCCCTCCTCGTCGTCATCATAGTAAAGATCGTCTTGTGTGATGGAGAAGATGCTATCATTACTGTCGTTCGA
GTTGATTTGATTTAGACCAAAATCGGTGACATCTGCAGATGTAAAAAGAAAAAGGAGTTAGAAATCACTGGAGAATATTAAGAGCTTCTAGGCGCACCTG
AAAAGGAAGTCTGGGATTCGAGGAGCGATGAGGAGCTTGAGGTGCTTTTCAACGGAGTCTGAAACATAGTAACAAAGCGTGAGTTGGATGTGGACGAACT
GTAAATGATAAGATGTGACCACCTTACCTTCAATGACTTAGGGTCTACCCGGAAGGAAGACTGCAGATTGCGCGCAATTTCGGCGAGCTCCATCGCCTGT
TGCTGTAAAAAGTCATTTCCAGCGCCGCAACTCGAGTCGAAAATGCCTGCACCAGTGTGTGAGCCCTTAAAACTGGAGGTGAGGGAGCCATCTTCACTGC
TTTCACGTGTCGATGACGAGTCTGTGAGGTCATCTTTATTCAGGTTGCGCGCCATTTCTGCCAATTCAGCTGCTTGCTGTTGGATGGATTCGTTCTCTGC
AGCGTCATTGAAGTTAGCTGAAGTCGCACTCAACGGATATGTTAGCGACTCTGCAGAAACAGGGCTCGTCTTTTGAGTCGCAGGCGCTGCCACAGCCTCT
TGCTTAGGGAGTATGGATACTGGCATACATTCCTGGTGAGGAGATGCTGGCTGCTCGTGTCCTGCTTCGGTTTGATCCACTCCATTGTACTGCTCGTCTT
CATGGGGCGAAGGGACCCCCGCGGACTCAACCACCAGGCTCACATTTTGGATATGTTCCCTCCCGTCTTCTCGGCTTATATCACCCTGCGCAGCATCGAT
ACCTTCTACCCCGTCCTCGTGTTCATCTCCAGGTACTTCGTCATCTTCTGAAAGCACATCAGAAACGGCCGAGCCGCGAGACAACTTGGATATTTCCATC
GCAGCGTCGTCCAGCATGGCATCCAAATCCAACTCTTCTCCATCAGCATCGCCTTCCTTTCCATGACACTCCTTGTCCCCGTCATTTTCTGCTCGTGCCT
CCAACTCGTCACTTCCTTTACGTCCCTGGCGTTCATTCCGTCCTCGATTTTTCACTTCCTTATCTGGCGCTTCAAACACCTCCAGACATTTCTGAAGCTC
CTCAATCTCGTGCCTCTGCTTTCCACCATCCGCAGAGCATCGCGCAGCATCTCCGACGTCTCCGAGTCGTCTTCACTGGCTCGTTTCCGCCGTCGCGAGA
GATGATGTCTTGGCGACTGCAAGATCACCATCGACGAAGCAGACGTCGACGACGCCGAGCTGGAGGACCTTGACAGTCTCCTGGCTAGAGCGAGCGCCGC
CTTGCCGTCCATACTGTTCTTCCTTGTGGCCTCCACATTGCCCGCAGCTTGGCGCAGCTGCTCGATCCATTCCATCCGCGCCTCGTGGGACGGCGCGCGG
AAGAGCAGCACGCGACCACTGCAGGACGTGACTTTCCAGCACGGGCCGCAGTCGTCCCCGCAGTTGGCCGCGTCTCCGTGGCGGAAGATGCGGTCCACGG
CCTTGATATCGGCGTCCACGAGCGGCACAACGGCGCGCGGCCAGTCGCCCAGGTGGGCGTAGTAGTAGAGCGCGTGCGCGTGGATGCCTACGAAGAAGGG
CTCCCACGGCGACTCGAAGCGCCGGCCTTTCTTGTGCAAAATGCGCAGCGTCGTGCGCTGCTCCAGCTCCAGCCCCGTGAGCAGCAGCTCCGGGCACTTG
ACGAGCTCCGGTCGCGGCGAGGAGCTCGGGGTCTCTTCCTCCTCGATGGGGATCTGCACCGTGAGCCGCGAGACGCGGCTGCCGCTCGGGTCGAACACCG
ACGAGCGCATGATGAGGGAGTGCGTGCGTCGAGCGCCAAGTGATGGCGTCTTCGATGCCTCACGCCGGAGAGGAATGGCAGAGTGAGGAAGGGCAACGGC
ATGTCCGGTGAATAGGGCGGCGAACCGGTGCAGTGGGCAGACGGGGCGAGGGGTAATGCACCCCGAATTAGGAGTCCGACACCCGCATTTAGATATGAAC
GCCCGGCTCTGCGCTGGAGTCGTCGGTTCGTATCAGACACAGCAGGGCAACATGGCGAAAGAGAGACGACGACGAGCTGCCTGCCCGCGGCATTTGCTTG
CCTGGAAATCGTCGGCAGAGCTGCTGCTCCGCGCGGGATAGAATTGCGGAGGTTTGCTTGTCGAGCGGTTCCCTAGATGCGAGCAGATCACCGCGTAGGT
TGAAATATCGCGCTCGTAGTCGCTGGCTTGTCCTCGCGGCGTCGGCGTTCCAATGCGGGCGGCCATAGAAGCCCCGGCGTCTTCGCCGACGCTTTACTGC
GAAGCCCACAACTCGGTCGTGGGCCACAATCACGAGCAGCGTCGCCGCCGTCGCTGACTCTCCGGCTTTTTTATTTGAGCTCGTTCAGCCCGATCTTTTG
GGCGTGCGTCACGCACTGCGGGGGGAAACAAGTACCAGTACTTATCTATACAAGTCTTCGCGGTGCGAGTCGCATCTCGTGCCTCACGCATTTCAGCGAG
GCGGCCTTTCACATCCCAAGCATTTCGCGAGCCTTTCCAACGCAGCCTCGAAAAAAACTTGGACGAAAGCCAGCCAGCCAGGGCAACGGAGCTCCTTGCC
TGTCAGGTTCAGTAGAGGAGGATGCCGCGTTTTGATATTCGCCAAGCGAGTCTCGGTGGAGTCCTCAACAAACTCGGCTGGGCGGTGATTACCAGCAAAA
AGCACCCGTCGAACGACTCAATGCATCAATCAACGGCAGCGGCCTCGATCTCTACTGAGCTACTCTCTCCACAGAGAGCGTGACGCCATTCCATCCAGCA
CAAACAGCCTCATGGGTAGCAGCTGCAGCCAGCGAAATGCAAGGCATCAAGGCCTCCAGCTATTCATCGAGCCAAGTGCTCGACTGCTCGTCTACAAGAC
GTAGCACGAGAAGTTGCTGCGAAATTGATTCAGCCAATGGGGTGCGTGCATTCGAATTTTGACCAATCGCCAAAACTGCGTAAATTTCTGTGCGCACTTT
GTCTCGTACTGCGAGCGCGGTCCGGTTCGGCGATGCGGTTCGAGAATCGGGCATACAATCAGCAAGTGCTTTGCGGGACCGGTCCCAAGATGAAGCGGAA
ATGCTGTGCGATTTATTTTCTGTGGCCTCCGAGCGCTTGGCTACCAGAGCTCGTCCATTCGGCCCTTTGCCCAGATCAGCAGCATCTTACTCCCGTCTCG
CCCGGCAGCCATGGTACGTTTCTCACGAGCCTCTTCTCGAGATGGCTGCAGCCCTGCGCGACACGACGCGACGCGGGGGAACCGGGCGACTAAAAGGGGA
GACGGCGGACAGCCCGCCAGCTGCAGCGTCCAGGTGGAAATCAGTGCGATCTTTAGCCCGTGTGGACGCTCGCAATGACGGCGCCTTCCCACTGTCCCCT
GTCTTCACGGAGATCCTCCTAGTCGCTCCTCCCCGCTGTCCTGCGTGTTCTGTGGCTGCGTTGATTCACATGATACAGACAGACGATTGACTGGATGGTT
GGCGCTGTGTGCACAGGCCAGCAAGTACCAGAACATCTTCGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGGCCACGCCTCCC
CCGTCGGCCCCCGTCGCTCTGAACAAGCCCGCCGCTGGAAACAAGAAGACTGCCAACAAGTCGGCCCCCGTCGGCGACAAGAAGGAGTCGCGTGGACCGC
GTGAGGGTGGCCGTGCCCCGCGTGAGCGCGGCGAGCGTGGTGGCCGTGGCAACCGTGGACCTCGTCGCGAGTTTGAGCGTCGCAGCGGCACAGGCCGTGG
AAAGGAGACCAGCAAGCAGGGCGGTGGTGCCCGCAACTGGGGCAACAAGGCTGATCCCGCCGAGCAGTTGGCTGAGGCCGCTGCCCAGGACAGCGCCAAG
CCCGCCTCGGATGAGGAGGCCACTGAGGAGGTCGCCGCCGTGGAAGAGGAAGAGGAGGAGGTGCAGCTCACCCTCGACGAGTACCTTGCCAAGCAGAAGG
AGTCGCGCTCGGGCGACCTCTTCGCTGACGTGGAGGTGCGCCAGGTGGCCAACGAGTTCTCGAGCGCCGTGCAGATCACCAAGGACGGCAAGACCCCGGA
CTTCATGGACTCGCAGTACGAGAAGGTCTACAGCAAGAAGACCTCTGGCCGCAAGAAACAGCTCATCACCGACGTGGGCTTCCGCACGGAGAAGCCGGAG
CGCTTTACGCGCGAATTCGACTCGTCGCGTGGCGGCCGTGGTCGTGGCGGCCGTGGTGGTGCTCGTGGCAACGGCCGCACCGGTGGCCGTGGCGGCCGTG
GCTCCAACGTCCCGAACGTGACGGACATGAGCGCCTTCCCCAGCCTCGGCTAGGGATCGCATCGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCAGCG
ACATGATGAGTGAGATCTTCCACAAGAGGGCTTCTCGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCGACGAAAGATCCACCGGATAGGGCC
TCTGCGCGGCTGGTGTCTGCCTGACTGTGTGTACCCTCCTGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCT
TCTCCTTGGTATGTCTATTATTCAATGCAGCAGGCTGGGCTTTATGCGAACGAAAATACCGTTTTATCATCCGTGGCCTTTGTTTTACTTTGTTGTTGTT
GTTGCGCGTATCTTCACGAACACGTTGCCGCTTATCTGCAGGACGTTACAGTGACTGATGTTCAGCAATACGACGTGCCTTGACGCTGTCTGGTAGTACT
ACGATGGTGCCGTGAGCCGCCCAATAAAAAGGTGTTTGCCGTTGGTTGTCAGTTTCCCACGCTTGAACACCCCAGCCTCACACGGGGGTCGTGCTTCCAC
GATGAGCTCGCTTCCTTCGTCATCTTCATCATGTTCCCGAGAGAAAATGCCGCGGCCGGAGGGAAACCCATGAATCCACGTACCAATGAACTTCCGTCCG
TCAGGGGAAGACCACAATCCATAGCCGTGGACCTCGCCCATGTACCATTCGCCGTCGTAGACTTCCCCCGAGGCAAACGTCAGCGCGCCAAACCCATTTC
GCTCGCCAGCTTTATACTCGCCAGCGTACACGCTCCCGCACTGGAAATGGTGCACGCCCTGACCGCTCAGCTCCCCGTTATTCCACATGCCGTGCAGGGA
GCCTCCTGAAAAAATGTACACACCTTTGCCATGCATTAACCCTTGGTGCCACGTGCCTTCGTGCGAGTCTCCACCCACCCACTCATACTTGCCAAACCCT
TCGCGCTCACCCTTCACAAAGTACCCCTCGTACTTGTCCCCCGAGCTGAACACCTTGGTTCCCCACCCGCTCACCTGGTTGTGTCTCCAAGTGCCGTCAA
CCATTTCACCTGAGGACAGGAGCTTTTTGCCTTTGCCATGCATATCCCCCTTCTTCCACTCGCCTAAACGAGCAGCACAGCGCACACACGGCTCAAAGGG
TGGACACACGGACATGGTGTAGATTTTCCTTCTCACCACGATAGCTGTCTCCATTCTTCCAGAAGAAGGTGCCGTTTCCATGCATCTACCATAAGTCTCC
CATCAGCACCCGAATAAAAGTGAGCAAGTACTAAAACCTTTTAAGTACCTTGCCTACTCGCCAATTGCCGACGTACTTGTCCCCATTAGCCCACAGGTAC
GTCCCAGTTCCGTGGCGGTGGTTCTTCCGATACATGCCTTCATGGCAGTCTCCAGTACCTGCAAAGGTTTGCATGCCGAACCTGCACCAAAGGCCAACAA
AACATTATTAGCAGACCAACGCGTTGTCCACCCGTCAGTGACGCTCGCACCCTTCGAAGTCTCCGTGCACCCAGCCACCTTCAAAAATGTGCCCGGATCT
CAATATGTGGACACCAGTGCCGTGTCGCCTCTCCTCGTCATCTACGCTGCCTTCGTAGCGACTGCCGTCCGCGTACTGGACCACGACGGCCCCTCGCGGC
TTCTTCCGGCGGATCGAGAGAATCTCCGCGTTGCGATCGCCCGAGGAGGCAGCAGACGCGTCGTCCGCCTCGAACTGCGGCGTTGGTTCCTGCTTCTGCA
CGCGCCCGGCGGCTGTCGGGTCGGCTCGGTACGCACCGAAGCGGGACCCGCGGCGTCGACCCCGGTTCCCCATCGGCAGTCGCGGATCAAAAGCAGCAGT
GCGCAATGTTCGATCCGTCGCTGTACTACACTGTGAGTGATGGTCTCTGACCAATTTGATCCAAATACAGGACTAAATACGGATACTGAAATCAAGTCGC
GACCGACGGACTTGATCCGCCACCTTATCAATATGTTTGTGGCACTCCGCGCGTTCCTGGCGCTCGTGTGGTGGCACCTGTGCCACTTCCTAGCCTACAA
CCTGCACGTACGCGGCCTCAAACCGTCCAGCCAGTTCTTCCACAAGGTCGTGATCATTGGCGACGACTTTGCAGCAGGCATCGGAGACTACGTCACGATT
GGCGGCGCTGGCGGCGGCATTGCCGAATACCTAAAGAAGGTCGTCTCGCATGACGACAAGGCAAGTGAAGCGCTAACGTCGAGATAAACTGCTGTAATTG
CAGCGCCACGATGGCCCTTGTTAGGTCACTTTGCAGCGTGCTCGCAAGCTTACTCACAAGATACTTTCTGTGCTAACCGCAGGTTCGTCACAACTGGGTC
ATCGTCAACGCCGGGGTACCTGGAACCACAACGGCCGACTGGCTCATGTCATCGCCGAAGAAGGTGCATCGATAGTAGCTATCGGAGACTTGTGGCCTGA
CTGACAAAACGAAATGCTGCACACGAGTTAGTACTTCAAGAACGTCTTTACCTCGAGAGCCATGGCGGACGCGTCAATCGTGATCATCGTTCTCGGATCT
GTGGAGATCAAGTGAGAAGCGTGGAGGCGCTATTGCATTGCGCAGCGAAGCGCCATTTTTCTAACATTATTGTGGTTGCTGCTGGCACCTGGATAGAAAC
CCAGCTGCCGCTGGACACGAGATGAAGCGCCACCTCATGGAGATCTGTGATACTTTGCGTAAGAAGGGCAAGCAGGTGTGCCTGGCCACTGTTGCGAGCC
CCGACCCAACTGCTGATGAAACGGACACCGCCAGCTCGACCCTCAACACGGCACTGGAGCAATTTTGCAAGAGGTACGGCGAGGTTCGAATCCATCGACT
TACTCTCGCGAGCAGGGATGAGCAAGTGTGGTTGCTAGGAAGTGGTCAACTAACTCTCACGCATATGTGATGGATTGGACAGCACATCAACGGAAGAGAC
GCCCGTTATCCTGGGCCCACGCCTTGACACGTATGCATTCCGTCGCGAAAGCGCGCTTTCGTTCGACAAGTACCACTTCAACTCTCAGGTACGATAGCTT
GCAGCAAGCCTTCAACCTGTAGTCATTCCATTCCAAGCTGCCGTTCTAAAGCGAGATCTCACTCACCACCCGCCTCTCTGCACCTCGTAGTCGTACCGAC
AGCTAGCTCGCAACACGGCGGATTTCTTGGTCCCCATGATGACGGCACAGGAATGGACTACTTGGAAGGAGCAGCTCAGCCATGTCACCTACGACAAGGC
CTTGTACGATTAGAACTTTCGTCATGCACGCCGTTCCGTTGCCGACTCGTTTATCGGCTCTGCAAAATATGCCATACGCCAGCAGACAGCTTCGGAGGTA
TCCGCGCTTGCATCCTCCTAGCTGGAGCCAACTGGCTGACTGGCTGACTGCTTGCGCTCGCGTCCGTCCACCATCCAGAAAAGATAAACATTAACACCAC
AGGAAACACGCGGGCTTTCTTTTTCTTTCGTTTTGGGTATTGCCTGGTCTCGCCGCCTTCGCTCTCGCGAAGTTTATGTGAGCTTCTTGTTCGCTTCACA
CGCGGCCTTCTCAATGTGTGCATCTCCATCGCTTCCATGCCATTGATCTACATGTCCACGTCTGTCGTCAATGACTACAACTCGTCATCTCCTTCTCAAG
ACTCCATAGCAGCGTCCGGGGCCGGCTCGCCCTCCGTCTTGGTGGTGGTGGCGGTGGCTTGCGTCGGCTTGGCAGCCCAGTAGTCCTCCATCTGACGGTC
CAATTGGGCAGCCTTGGGGTCGGGGCCCTTGCCGGCTTCGTGCCAGTACTCGTC