Description :
From Genome Similarity Track
Location :
Scaffold_10:364327- 367109
Sequence
2782 bases(100 bases per row)
TGTCTGAGCTGATCAAGGAATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCGTGGGCCTCGCCGATTGGCGTGATCATCAAGAAGAACGGCGT
GGGTATCCGACTCTGTATCGACTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTGTATCCGATGCCCTTGATCAACGCTCTGCTGGAAGATCTGGAC
AAGGTACTCTGGTATTGCTCTTTGGACATGGCGAGTGGATTTTGGGTAGTGACAATGACCGATCGAGCTCGTGCGATCTCGGCCTTTATCACCCACATGG
CCGTTCGGCCTGAAGAACCCTCCTCAGATCTATCAGCGACTTCTGGACGACGCGTTGTATGGGTTCACCAGGATCCCGTGATCGTCGGACTGTGAAGTCA
CTACGGATTTGATCGAGTCAGGAGAACCAGAAGATCCGGAGCGTCCATCAGTGCTAGGTCGCAGATCGTACATTGATGACATTCTTGTGACGGCCGGGTC
ATGGGACGAGCTGTGTGATCGCGTTGACCACCTGCTGGACGCTTGTGATAAGTGGAACCTCTCGATCAGTGTGGAGAAGAGCTCTTGGGGGATGCGTGAG
GTGGACTATCTGGGACATCGTGTGTCGAACGATGGGCTGGAGGCCAATCTGAAGGATCTCACTGCCCTGACTGCTCTGCCGTTCCCCGGATCGCTCCGAT
CGATGCAGTCATTCTTGGGCAGTCTCAACTACTACAGCCGTTTCTTGGAAGATTACGCGATCTACGCGGCGATCCTGTACGAACTGCGCGAGGTGGACTT
CGCTGAGCTGAAGAAGCGCCCCGATCTGCGCCAGATCCTGAATGGATACGGAACCAGTGAGCCCGAATCGGACTCCATCCGTTCCTGAAGTCGGTGTTGC
CGATGAACGCTGAACCCGTGCTTATCGTGCCTTTGCGACACTGAAGACGAAGATCGCGACGACGCCGATCCTGCGGCATTTCGATCGCGATCGGACTCCG
GTCGTTATTGTGTTTGCGAGTGACTGGGCGATCTCGGTCGCATTGATGCAGGAGCACGACCAGATCTACCATCCCGTTACCTTCGCCAGTCGAACGCTGA
AGTCGAATGAATTGAACTACAACGTTGTGGAGAAAGAAGTACTGGCGCTGTTACGGATCCTGGACCTAAACTATAACATGCAGGTTGGACGATCGATCCG
GGTCTTGACCCGACACTCGACGTCGGCGTGGCTGTTCCGATCACCCGGTCTTCAAGGCCGATTGGGTCAGTGGGCTGCACTCCTATCGCCCTGGACACTG
GAGACCACGAAGTGCACCAAGGGAGAGGACGAGATATTGGGGGTGATCACCGCTAGTATTACGCCTCGATCGGATATGGACGACGGGTTGATCGCGATCG
CGCCGAAGAAAGAACCCCGGCAGAAGATTCAGGCCCCGATCCCGACTGTGCGTGCGGACGAAGAGCTGCTGGTGATAAGTTTCGATGGATCCGCCCGCGT
CAAGCGAGGCGGGGGCGCGTACAGCGCGATCTTGTGGAAAATACCCGAATGGAGCGTGGTGAAGGCACGATCGGGCTATGCTGAAGGGCTGACGGTTAAC
GAGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTTGACGGCATAGATCGAGGCAGGTTAGTGGTCTGCGGCGATTCCAACCTGGTGATCCGAC
AAGTACGGGGCGAGATCGACTGCAAAGCACCTAAGCTGACATTGTTGAAGCAGAAGGTGCTGGACCAACTACGGAACTGGCCAGATCACGAGCTGTTACA
TGTGAAACGAGACTGGAACGGGAGTGCAGACAGCCTGGCCAGTGCAGCACTCCAACGTGAAGGGGGCGTCGTCGTCGAGGATGAGGTCGATCATGGGGAT
TTAGTGACACTGAACCGACTTGATGAGATCCTGGTTGTTCGATCGGATGAGTCGATCGCCCGACTATCGCCGATGACCACCCGATCGGGCGCCAGATCAC
GGCCGAACCCGACCGTCATGCAAGAGGAGTTCGTGCGAGGGTTGTGGATCGACCGAATTCGTCGAGCTCAAGATGAAGAAACGTGGATCGCGGGTATGAA
GAAGTACCTGATGGGAGATGTGGCTGAACTGACGCAGGATGAGGCTCGATCCTATGGCAACATCGCAGCGGATTATGAGATCGACGGTGATAATCTGCTG
TTCTATTGCCCGCCCTCCAAACGATCGGAGGCAGATCGAGATGGACTGACGAGGCTGGTTGCACCAGAGACGCTCCATCAAGATATATCACTCCACTCTG
GAAGGTGGACACCAGGGGATCGGGCGTACCTATCAGCGGATCCGCGATCACTTTCATTGGACAGGTTTCTTCAGGAGTGTGCAAAAGTACGTCGGTGAAT
GTGTCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGAGCGAGTCGCCGGGGAATATCCAGACGACATACCCGTTCCAGATCATAGCAATGGATCA
CATACCTTCGCTACCCAAGTCGTACAAGGGTAATACGGAAGTGTTGATTTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCGTCCCGA
ACGGCGCAGACGATCGCCGAGTCTTACGAAGAGTGCGTGTTCAGGCGATTTGGTGCTAGCGAGGTGATCAGACATGATCGCGAACCGGGATTTATGGCCG
ACTTCTTCCGCGCCTTTAACAAGATCCTGGGTACGCGTCAGCGAGCGACGATGACATATCGACCTCAAGCTAACGGTACTGC