Description :
From Genome Similarity Track
Location :
Scaffold_223:36422- 42021
Transcript NameFunction/comments
Phyci_168967Hypothetical protein

Sequence
5599 bases(100 bases per row)
gacatgcctccatgtgtgctacagcaccatgacacactcgctccggccatttggatcacatacccagttacggatttacgttcttttgattgacacgcga
agctcgcgtcagtgtacatttcgtaagtcacgtctctcttttttttcatcgagaaacagaccgtacgttgacgtccatttcaagtatttgagtactcgcc
tagctgcatcccaatgcgtgcggttgtagcaagatagaaatttgcttaattctctaaccgcgttggcgatatccgggcgtgtgccacggaccaaatattg
gagtgaaccaacaatacctctatagtcaaagggctgcgcagcaatttgctctgcgcttagtttcatctcgggctcgagtacgaggccaggcacttgtggt
gtcattactggcgcgcatttgcccagtttgtactttgtaaccaactctgcaatgtacttgcgctgtgagatcaccatcacacgctgatttctattgcggt
gcacctccatcttgaggatataatgaatgtcgcccaggtctttcattttgaaccggtttgacaattcggctttcagcctgttaaagagtcgcatatctcg
cgacatgatcgtcagatcatcgacatataccacgactatgatccattcttctcccactttttgcacgtagatgcaaaactctttgtggcagcgtgcaaaa
cccatcgacgtcaaaaaggtatgtaaaactcgatactagatgcgtggggcttgcttcaggccatagatgctcttttgaagttcacagaccaaatgctcat
ggcctcgcttcgcaaatccgtgaggttgcctcatatagatcttttgctctccgtccatcgtgccgttcagaaacgccgtatggacatccatctgatggat
gacagtccagtatcgtaacactaggtgcagtgactcgaatcgtgccactggtgcgtatacctcgtcacagtctaccccaaactcctggtggttgccttgt
gctacgaggcgtgctttgaaccactcgacagtcccgtcagcagcgttatactttacaagtagcacccaatgacatggcaaagccttacacccaggtggca
gtcgtacaagtctccacgtcccattctcgatcaaggagttgtactcaagttccagagcctgtttacactgctctctataagccccactcaacgcgtcttt
gagcgatcgtggtgttggcactctgttctctagaatgtcttgcgcaacgttgtgctctaacattgcctggaagtactgatagtccgagtatctcttcggt
ttcttcgccactcgacgtgagcggggctcgcgccttggtggcgtatccacgagtccccgcacgtcggcgtttcttagctcccactgctgggttactggtc
tgcgcaggttcttcagctcccactgctcctgtagactcggttgcaagtgaatctgctccctctgctgcgggtaactctcgcgcggcagattcaattgtga
gggcctcatcagtctgcccgaacgctggctggaccatggtgactacattggtcgtatcgaacaacacgtctcgtgattggttgtgcttgttgttgtacat
gtcccagagtcgataacccttcgtttcctccgacattccgaggaatcggcactttacggcacgagcagacagcttttgtcctttcataggacggcaggga
tatgtgcaacgcacacagagccccacacgggtagcttggtcacgttgggaggtgtcccatacaccatctcatacgtgtcttatttcccaaccgcgccata
ggtgtgcgattttgcacatacgtcatgtacataagtgccgctggccaccacttgtgtgccatatcagcgcctttcaacgcgcagcgaactctgtccagtt
tgctctgatgatctcgctctgcagcaccattctcttcagggctgtaggcattcgatgtctggaatacaattcctttgcttttacaaaagcttttaaaggc
tgcattcacaaactcagttcctccatcggacctgatccgacgaatcgtgaactttccctcacgctccagctgcaaaagcagctcctctactttctcaaat
acttctttcttattgcgcaggagataagtccaacgccatgacgtgttgtcgtcaatgatgctcagaaaatatttaattttcccgcagctgccatacaccc
caattgttttcatggggccgtttatgtccatgtgaatggtgctaatagggtgttcgtctctcgaacccctcgaattccggtaggacatcctccgtttctt
catctctgcacacgttgtgcagaaggacggaatttttcttagacctgacgcggataattttggcattccagccactaactttgcgcttagcatcgcaata
actgcctctttattgaggtggcctagtttgacatgccactcttgcagtgtgcgctcaaaccttttattattaaggtgagctagcggcttacagggccctt
gcttcactgcgttacacagcagttgtctttcttgcagcgttttattttgaatataatacgccccgttgatagctttcccaacaaaaactaattcgttttg
aaaagtacaaatttgtactcgccagttaaggatcccaaaatttggtacccaccgcgcctgagccagaactcgctcagaatgttcgaggtagtgtccggta
ctaacgcaatattttcgaaaagaaaaggtttaattcctcgtggaccatgcaagtacaactatattgtaccaatatgtgcatttgaatacttagagccctg
tgcaaatgtacacatgtactgggtgttgggctccttccgcacaaaccgcgctgtctcgctggttaggccatgcccgcaccctgagtcaagtacccaagaa
tttgtggttagatacatttcatcatctaacagaaatggatacaaacttggcacctttttctcgagctcagtcagcgtaccggcgaaggacttcgtcgtct
cagcaatctcttgattgctgtccttgcctggctgctcttccatgtccacgtcgcagtccggttccttacccgcggcttgagccttgcccgtgacgtcagc
attcactgcgttgacgacggtatccattggctcgtcttcgtcgctgaagggcggcgtgcccttcccggagtcacgggcacctcgaagttgctcggaggcg
ggttcgtgcacccatcagctgtcgctggtgacgcgccgtgctcagcgttgcacgcgtccaccgccacggcttcagccaggcactcatccagtgggacttc
acgtctcaccttggcccttcccttcccttgccgtttcccctcatcctgggcgttgactcgtggacttccttgcgaacctggcggcttggccttgaccaga
tgttccggcggtgcacgccagctgccttgtcaagtgcacgctggggcagttgatcatcttgtgtgatcatcttgtgtggcccaacatagttcattttgtt
gtgctcaccaccacagcagtgtcacttcactgcaccaatgttgtagtgcaaatcgcacactgacccgtctacggccttgcgcttgccaagcacaggcccc
ttcggatttgcaggagccgcgttgacatggttgaccacctttccgctgaccagagcgcagatctcgctcttgctcttggtgccgaagatggcattgagct
tgtcgctcaccttctcgagcgtaaatccatcctgggtcagctcaaccgaagagccccacatgtgcctcgggagcactccgagcaccatcaccagcataag
ctgggaggtcaacatgtggctgtgcagagcctcgtgcgcattcacgttgacttgactactcacactgttaagatcttgaaagagctaccccacgctcttg
aagtcagtgttcaccatctccatgaactgccgaaccagcccgacgacgcctgccgcgttgctgaggctgtactgtttttcaacaagccgccaaattacat
ggacgggctcgtcaatgtgcttggtcgcgattcccttgaaatcgcccggcagcggttcgcacagcagccgcttgatgtacgacgactgctgactcagccg
cgtctcgtgcagttcgtgctgccatgccgcgtctctatcctctgcaggaggacgcggctgcattatcggctggctctagagcaaatcctcgaaccgagtc
agcggctttgcacgcttgtgctgcagctcctccagcgcgcgttgcgcgcttagcgccttgaggtggataaccagcgagctctttcatgatgcgaagtgca
gaggctttccgctaaaccgcagcgagtcgaccgaactcttgtcaacttggggcttgctcatgttacttgaaatgctaaaatgaacagaatactgtaggta
actcactacaatatattactcttaacctcttattcctatgcctactactctaggcccgtcctcggtacctggaggcaaaagaggaagtgagttcgtcttc
ggaccgcgtcctcgacaactcactcctcggcctcttgtcgtcatcgtactatggatggcaggcagctctctgcctgtactatccagatcgcagctggcga
tctgaacattttcctctcgtacttgctaatataaatattaacaccttaacgaggtttttctttcattattcatttactctagtggcagacaggcgttgcc
tgctgccattctatgagcggggcgcgcgctgcgcgcctcctcattcaatagctatatctataataaaggcaggctatattagcgcttaaactggatacag
cattatagataaactcgggtatacccgcacccgaagctcgggtatacccggtcgggtaagcattttaccggggtccgggtacccgaatgcgagctctgGT
CGATACACACTGATTCATGGTTAATTGGGAATAACAACaagggccaggataggtcaattacaggtcagctcaatgtaggccaagtcgcactattggacta
cacatcattccgtcatcaatactactaatacACGAAGAGGTGAAAACTGGTCAATCAtattattattattattattattatttattaataatattTGGTC
ACGGATAAGACGGGCGAATAGGTTACACACCTCAACGCTAGGTCAGGTGACTAAACTAATTAGGTCACATCCTCACGAGATGTACATGAGATGGAGAGCT
AAATGCGCGCAATGTACACAACTGATGCTAAACGGAATCAGTTTTGTAACCAACTTGTAGGGGTGTTTTGCTATTTTATATTGACGCGGCTAGTCTTTCC
CATTCGCCTCTTCAGCCAGCATAATTCAAGTTTCCTCAGCGCACAACAATTCTCGCAGCTTCTTCTAGTCCCCACACCATGCCTTGACGTAGGTCGAACG
CTGCTTCTCCACCGCATATCAACCCATCATCCCGCCGGTCGCATCACCAACCACGTTCTCGTTTCACTCCATTGACCCGGAGGAGTACTCGTCCTCAACG
CCCGTTCCAATAAGAATCGGACGGTCATGTAATTGCCGGCATCGCCGATATGGATCCCGATTTGCGTTTGACACAAGCTATGCTTACTACTGCGGATAC