Description :
From Genome Similarity Track
Location :
Scaffold_169:36422- 39863
Sequence
3441 bases(100 bases per row)
GACCTATACGACATCCACTGGAATTGTTTAGCATTTTTCTAGAAGGAAGGTAGATTGCACTCTTCTGAAACGCCATAGACCTCGTCAGTGGAGTTTTACA
GTCTTGGATGTGAAACCAATGTCCATTTAATATTTATGCCGCCGGGGACAGAACGTTGCCAGCATTTTTGGTTCGTCTATTGTTTACTTGGATGTACGTA
AAACAGACAGGTAGTCACGCGATATACATACGTGGAACGTCATTAAATTCTGCCGCAGTTCATCATCGTTTTAGTCGACGCTTTAGTGCAAATGATACAC
TTGTTAACATGGTATGTTAGTTGGGGTAGACACAGCATAGTACGACGGTGATCGTCTCTTAGACCTCCGGTCGTTCAACATCATCATCTATAGACATGAA
TGTAGATTACTTGTTGACGTCAAGGAGCCCAGCGGGGTTCAATATCAAATATTCATTTCTCTGTAACTAAGCATCCATTCGTTTTATATCTTGGTCTCAG
GAGCACAAAACAAACCTCTATCACAACTGAGCAATTAAACCACCCGCAATCACACACCCCAGCTGCTGTATTCTTGTCTCGCCTACTGTTCTCCACTCGG
ATTGGCCTCTTATATCTAGCGACGCGGTGTTATTCCAGCCGCTTTGCTAACATGTGTACAGCGTTTTGCTGTCGCTCCCACTACTGTCATCCAATCCAGT
CTGGCATCGGCGAAAAGGCTCGCTCAAATTTGACAGTGATTTTGTTTCCACGTTCCCACTCTCGAAATCCTCACTGTAAACTCAGGATTGGAAGAAAATG
AATTGATTGTTATATTGACAAACTGTAGGGGGCGATATGATTGTCAAGACCTATACAACATCCACTGGAATTGTTTAGCATTATTCTAAGGAAGGTAGAC
TGCACTCTTCTGAACCGCCATTGACCTCGTCAGTGGGGGTTTACAGTCTTGGATGTGAAACCAATGTCCATTTAATATTTATGCCGCCGGGGACAGAACG
TTGCCAGCATTTTTGGTTCGTCTATTGTTTACTTGGATGTACGTAAAAACAGACAAGGTAGTCACGAGATATACATACGTGGAACGTCATTAAATGCTGC
CGCAGTTCATCATCGTTTTAGCTGACGCTTTAGTGCAAATGATACACTTCTTTACCATGGTATGCTAGTTGGGGTAGACACAGCATAGTACGACGGTGAT
CGTCGCTTAGACCGCCGGTCGTTCAACATCGTCATCTATAGACATGAATGTAGATTACTTGTTGACGTCAAGGAGCCCAGCGGGGTTCAATATCAAATAT
TCATTTCTCTGTAACTAAGCATCCATTCATTTTATATCTTGGTCTCAGGAACACAAAACAAACCTCTATCACAACTGAGCAATTAAACCACCCGCAATCA
CACACCCCAGCTGCTGTATTCTTGTCTCGCCTACTGTTCTCCACTCGGATTGGCCTCTTGTCTCTAGCGACGCGGTGTTATTCCAGCCGCTTTGCTAACA
TGTGTACAGCGTTTTGTTGTCGCTCCCACTACTGTCATCCAATCCAGTCTGGCATCGGCGAAAAAGGCTCGCTCAAATTTGACAGTGATTTTGTTTCCAC
GTTCCCACTCTCGAAATCCTCACTGTAAACTCAGGGATTGGAAGAAATGAATTGATTGTTAATATTGACAAAACTGTAGGGGGCAATATTGATTGTCAAG
ACCTATACAACATCCACTGGAATTGTTTAGCATTTTTCTAAGGAAGGTAGACTGCACTCTTCTGAACCGCCATTGACCTCGTCAGTGGGGTTTTACAGTC
TTGGATGTGAGACCAATGTCCATTTAATATTTATGCCGCCGGGGACAGAACGTTGCCAGCATTTTTGGTTCGTCTATTGTTTACTTGGATGTACGTAAAA
CATACAGGTAGTCACGAGATATACATACGTGGAACGTCATTAAATTCTGCCGCAGTTCATCATCGTTTTAGTCGACGCTTTAGTGCAAATGATACACTTG
TTAACATTGTATGTTAGTTGGGGTAGACACAGCATAGTACGACGGTGATCGTCTCTTAGACCGCCGGTCGTTCAACATCGTCATCTATAGACATGAATGT
AAATTACTTGTTGATGTCAAGGAGCCCAGCGGGGTTCAATATCAAATATTGACTTTCTCTGTAACTAAGCATCCATTCATTTTATATCTTGGTCTCAGGA
ACACAAAACAAACCTTTATCACAACTGAGCAATTAAACCACCCGCAATCACACACCCCAGCAGCTGTATTCTTGTCTCGCCTACTGTTCTCCACTCGGAT
TGGCCTCTTAAATCTAGCGACACGGTGTTATTCCAGCCGCTTTGCATAACATGTGAACGGCGTTTTAATGTCGCTCGCACTACTGTCATCCGTTTTAGTC
GTGGCTTCAGTGCAAATGATAGGCTTGCTAACATTTGATATGTTAGTTTGTGTATCCACAGCATAGTACGACGGTAATCGTCTCTTAGACCGCCGGTCGT
TCAACAAATCAATTCATTCTTAATATAGACATGAATTGTAGGGATTACTTGTTGATTGTCAAGGAGCCCAGCGGGGTTCCAATATCAAATATTTTTCATT
TCTCTGTAAACTAAGGACAAATTCCATTCGTTTTAATATCCCTTGGTCTCCTCAGGAGCACAAAACAAACCTCTATCACAACTGAGCAATTAAACCACCC
GCAATCACACACCCCAGCTGCTGTATTCTTGTCTCGCCTACTGTTCTCCACTCGGATTGGCCTCTTATATCTAGCGACGCGGTGTTATTCCAGCCGCTTT
GCTAACATGTGTACAGCGTTTTGTTGTCGCTCCCACTACTGTCATCCAATCCAGTCTGGCATCGGCGAAAAAGGCTCGCTCAAATTTGACAGTGATTTTG
TTTCCACGTTCCCACTCTCGAAATCCTCACTGTAAACTCAGGGATTGGAAGAAATAAACTGATTGTTAATATTGACAAAACTGTAGGGGGCAATATTGAT
TGTCAAGACCTATACAACATCCACTGGAATTGTTTAGCATTTTTCTAAGGAAGGTAGACTGCACTCTTCTGAACCGCCATTGACCTCGTCAGTGGAGTTT
TACAGTCTTGGATGTGAAACCAATGTCCATTTAATATTTATGCCGCCGGGGACAGAACGTTGCCAGCATTTTTGGTTCGTCTATTGTTTACTTGGATGTA
CGTAAAACAGACAGGTAGTCACGCGATATACATACGTGGAACGTCATTAAATTCTGCCGCAGTTCATCATCGTTTTAGTCGACGCTTTAGTGCAAATGAT
ACACTTGTTAACACGGTATGTTAGTTGGGGTAGACACAGCATAGTACGACGGTGATCGTCTCTTAGACCGCCGGTCGTTCAACATCATCATCTATAGACA
TGAATGTAGATTACTTGTTGACGTCAAGGAGCCCAGCGGGA