Description :
From Genome Similarity Track
Location :
Scaffold_1340:3641- 5476
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1340-snap-gene-0.52-isopropylmalate synthase
Pytar_ATCC12531maker-par_contig_1340-snap-gene-0.8Tyrosine phosphatase family protein

Sequence
1835 bases(100 bases per row)
TCGACACGACGCTGCGAGACGGTGAGCAGTCGCCCGGCGCGACGCTCAACTTCCGCGAGAAGCTCGACATTGCGCGCGCGCTCAGCCTCATGGGCGTCGA
CGTGTGCGAGGCCGGCTTCCCGATCTCGTCCCCGGGCGACTTCGAGGCCGTGGCGGCCATCGCCAAGGAGATTGGTCCGCTCACGACCAACCGCAAGACT
GGTCTCCCGATGACGATTGCCGGTCTGGCGCGCGCGACCGAAAAGGACATTCAGCGCTGCTACGACGCCGTCAAGCACGCGCCGTCGCACCGCATCCACA
CGTTTCTCGCGACGTCCGATATCCACCTCAAGTACAAGCTCAAGATTTCGCGCGACGAGTGCATCCGCCGCGCCGTCGAGGCCGTCAAGTTTGCGTCGAG
CCTGACGCCCGACGTCGAGTTCTCGCCCGAGGACGCGGGCCGCAGTGACCCGGATTTCCTGTGCGAAGTGCTGGGCGAGGTCATCAAGGCCGGCGCCACG
ACGCTCAACATTCCCGACACGGTCGGCTACACGGTGCCGGAGGAGTACGGCTCGCTGTTCAAGTACCTGATTGAGAACACGCCCGGCAGCGACAAGGCCG
TCTTCTCGACCCACTGCCACAACGACTTGGGGCTGGCCACGGCCAACGCGCTGGCCGGCATCCAGGGCGGCGCGCGCCAGTGCGAGGTCACGCTCAACGG
CATTGGCGAGCGCGCGGGCAACACGGCGCTCGAGGAGATCATCATGACGCTCAAGACGCGGCCGCAGCACTTTCCCGTCTACTCGACCGTGGACTCGACC
CACATTATGCGCACGAGCCGCATGGTGTCGCACTACACGGGCATGGCCGTGCAGCCCAACAAGGCCATTGTGGGCGCCAACGCGTTTGCCCACGAGTCGG
GCATCCACCAGGACGGCGTGCTCAAGCACCAGGCCACGTACGAGATCATGCTGCCCGAGTCGGTCGGTCTCACGGAAAACAAGATGGTGCTGGGCAAGCA
CTCGGGCCGCCACGCGTACGGCAAGCGTCTCGAGCAGTTGGGCTTCACGGACCTCACGCCCGAGCAGCTCGATTACTATGTCGACAAGTTCAAGGTCCTG
GCCGACGAGAAGAAGGTGGTGACGGACGCCGACATTGAAGCCATCGTGTCGGACCAGCTCTACAAGCCCGAGACGTACTGGACGCTCACGTCGGTCCACG
TCACGGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACCGGGTCAAGCCCACGGCTACG
GTCACGCTTGCGTTCAAGGACGGCTCGGAAGTGAGCGAGGCCGCCATGGGCACCGGACCGATCGATGCGATTTACGTGGCCATCAAGCGCGCGACCGGCA
TGACCGACATGAAGCTCAACGAGTACTCGGTCAACAGCATCACGGACGGCACGTCGGCGCTGGGCGAAGTCACGGTGCGGGTCGAGGCCGAGACCGACAC
GGTGGCGTCGCCGGGCGATCTCGTGAACCCGCAGACGGGCGTGGCGCGCAACCGCCAGTACGTCGGCCACGGCGCCAACACGGACATTCTCGTGGCGTCG
GCCACGGCGTACGTGAACGCCGTGAACCGCTTGCTGGCGGCCAACGAGCGAATGCTGGCCGGCGACAAGAACGGCGAGGCGCGAGTGGAGGCCCATTAGG
CGAGCGCATGAAGGAAATATACACCCCACCCACACATGTTACTCCTCTCTCATAAATACTGTAGACGATTAGTTAGACACCGGCGAGATCCAGTGCCTCG
AGCGACCGAGGGATCGCAATGTCCTGCAGCGCCTC