Description :
From Genome Similarity Track
Location :
Scaffold_921:3640- 4691
Sequence
1051 bases(100 bases per row)
TTTATCTTTGTTTCCATCCTTACAGAGGAACAGTCTTTAACAGACTCAGGTGTAGATTGACTACAAGTGCTACCAAGTGTAGCGGAGCTACACTTACTCC
TTTGTCAGAGGAAGACTTCTGGACTCGTAGAGTCTCTTAGTATATCAAAATAAACGGGTATTAACCTAAAGGTTCTCAAGTCTTACAGACTTAGTGGGGA
CTTAACTTTGAGTGTATGTGCAAGCTCTTAAGATTCTAGTCCTGGTTCAGGGGACTACGAGTCCAAGGAATGACGTGGCATTAGTGCCCAAGAGTACTTA
GCCTTAACTCAGGCACTTAACTCTTACGACCAGAGACGTCTTAGAAAGACACGTGTCTGAAACTTATCAAAAGGGGAACTGAATATGTTTACTGATTTAT
AACGATAATAAACCTTACTTACGTCTTTAACCTTAAAACTATGCTACCTAATCGAAAAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTAAG
ACGCCTCTATGAAGACCCTATTACGATAGATATCCTCTAACCATAACTGATAGGGCATGGTATTATCGCTTAGCGTATGTGATACAAAGGTACGCCTTAT
CAGTGATTCTGATCTCTTTCTGTGTGTACCTCACCAATGTACCTGGTTATCGCAACCATTTGTGTAACCCCGTTACATATACTGAGTCAGAGAACTCACG
GGAGCTTGAAGTGCTGCTTCGTCAAGATTGCCGGTACGCCTTTGGCATTTTTGCGCATCGCGCTGAGGGTCAGCTTGCGGCCGACTCTCTTTCCGACAGT
AGGTGTGGGGATTTAAGGTTGCTCGCCTGAGAGGAATTTCCCGCGACTGCATGTGCAGTCGAAACATTGGAGAGTTGACCAGCAATTGTTTTCGCGTATC
GCGTGCGATACATTCTTCGCAGCTGTTCTTTGGTCTTCATTTTAGCAATACCGTATCCCAGTATACAGGCGTACTCCTTCAGCAATGTCATCTGTTGACT
GACTGTGCAGGTTCTCTTCCTCGCAAAAAATATGAGCTTTTGGACTTGCCA