Description :
From Genome Similarity Track
Location :
Scaffold_1431:364- 4655
Sequence
4291 bases(100 bases per row)
CACCTCAGTTCCGAGAAAAACTATTGGATCTGATTAAGGGCCTGGTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAAT
CATCGTCAAGAAGAACGGAGTGGATATACGTCTGTGTATTGATTAACGGCTAGTTAACGGCCTGACCCGACTGATGGTGTACCCAATGCCTCTAATCAAT
GAGCTATTGGAGGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTGTCTGGGTGGTGACTATGACGGATCGATCTCGCGCAGTAT
CCGCATTCATCACACCGTTTGGACTGTTCGAATGGGGCCGGATGCCGTTTGGATTGAAGAACGCGCCCCAGATCTACCTACGCCTGATCGATAACGCCCT
CTATGGATTCACCCAAATACCGGAACCCGAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTGGATTCATTCGAAGCAGGAGAGCCAGGGGATCCTGGG
ACCCCGTCTGGGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCAGAATCGTGGGATCAGTCGTGCGAGAGAGTGACATCCCTACTGTAGG
CGTGTACCAAGTGGAATCGCTCTATCAGCGTGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGTGAGGCG
AATCCTAAAGACCTGTCTTCGTTGGCAGACTTGTCCTTCCCCATAGTCGTTACGGGCGATGCAAATACTTATTGGGGCAGTTTGAGCTACTACAGTCGGG
TCATCGAGGATTACGCACTGTTTGCTGCGGTACTCTATGAACTGAGGGAGGTGGATTATGCTGCAATGGCCAACTTCGGCTGTCCGGATCAAAATCCAAC
AAAGCTCTGGCCCTAGAGATCCCAGACCCACGAAGGGATCCAAGTAGTACGACACCGGAAGACGACCTAAAACAGGAACTGGATCCACCCCGGGACCAAC
GGGGAGAGGATCGAATCTGGACAGAGACAACAGGGAAGAGTTTGGAAAAGGTGGAGCCTCGGTGGATCCGAGCTCAGCACGCGTTCGTGGAGCTAAGGAA
CAGGATTGCGACGACGCCCATCCTCCGCCATTTCGATCCGGAATGTCAGCCTACGGTGATAGTCTATGCTAGTGACTGGGCAGTCTCAGCAGCCTTGGTA
CAAGAACATGAGGGGATTTGCCATCCAGTCACTTTCGTCAGCCGGACGCTAAAGCCGAATGAGCTGAATTACGGAGCGGTGTAGAAGGAGATACTCGCGC
TCTTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTTGACCCTCTACGCTAGCTTGGTTGTTCAAGTCGGCCGG
TTCACAAGGACGGTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTG
GCCGTGAGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTATTAAAGAACCCAAACGCCGGATCCAGATCCAGATCCCGACGG
TACAGGTGGATGAGGATCTGTACGTTCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGCGACTGCCCGG
ATGCGAAGTTGTACGGGCCAGACCCACTTATGCGGAGGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGTGA
CAGGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGAATTGACGGCAAGGACCCGGCACTAACGCTGTTA
CGGCAGAAGGTGATGGTCCACCTGCGTGGCTGGATGAATCACGAATTAGTACATGTCAAGCGAGATTGGAAAGCCAGTGCAGATAGCTTGGCCAGTGCCG
CTTTACGGAATCAATGTGGTGTCGAGGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTCACGCTGAATCAAATAGATGAAGTGGTGGTGATTGGATCCGT
AAAAAGGACAGTCCAGGTAATGGCTGTCACTAGATCCAGAAGGAAGATTGGATCCAACCCCCAGATTCTCGATGAAACATCTGTGAAGGGAGTCCGTATT
GAGCGGATCCTCAAAGCACAGAACGAAGAAGCGTGGATCTTAGGACTAAAGAAATGTCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAAT
CCTACAGTATTATCGCTACGGATTATGCAGTGGATCTGAATGACTAGCTCTTCTATTGTCTCCCTACGAAGGGAGTCAACGAGGATCGGGATGGATTGAT
GAGACTGGTGATCCCGGAAACCTTACAACAGGATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGGATCGGTCGAACCTACCAACGG
ATCCGGGAATGTTTCCACTGGAGGGGACTACTCAAGAGTGTGCAACGATATGTCGGTGAGTGTGTGGGTTGTGAGACAGGCAAGGGCAGGCCCACAATCG
AAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCGTTCCAAATTATAGCCATGGATCACATCCCCTCGCTACCCAAGTCATTCAAAGAAAACACCGA
GTTGTTGATCTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCTAGCGCGTCCAGAACTGCACAGACCATCGCCGAATCGTACGACGAGTGTGTC
TTTCGGAGATTTGGGGCTAGTGAGATGATTTGGCATGATCGAGAGCCAGGCTTTGTGTCTGATTTCTTTCGAACCTTCAACCTGATTCTGGGACAGAGAC
AGCGGGCAACTATGGCATATCGTCCCCAAGCCAATGGATCTGCCGAACGCGTGGCACAGACGATCACGAGGGCGCTCAAGACGTATGTCCAGGACTTGGA
TCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTCCGCAATGAATATCGCACAGGAAAGGATCCGGGCCGATACCCCATTTTACTTGGTAAATGGG
TGGAATCCTAAATCTACCCTAGAAGCGGTCATTGCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACT
ACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTACGAAGTGCGATACAGGATCGATCGGATCGACACAACGAAGAAGCCCGTCCACATCAAATCCAAGT
GGGATCGCAGGTGTGGCTGTACCTAGATCGAGTGAAAGAAGGATACGCCCGTAAACTGGCCCATCTTTGGCACGGACCGTTTCGAGTAAGTGAAAAGATA
GGGGAACACGCCGTTAAGTTGGAAACGGCAGGTACCCAATATCGCTTGTTCCCCGTAGTACACGTATTCAAGCTGAAACGGGTCAGGGAATATCAGCACA
GGCCTGAGATCCGTCTTTCAGTGAATGAGTCCGACCGAATGGATTCTGACGAGGTCCTCCTACCGGAGGATAGTTGGAACGTGGATCTTGAAGCTGACGA
GTTCGAAGTCAAGATGATCGCCGACATGAGTTCAGGGAAGCGAACTAGATACGGACGAATTTACCGCAAATTTCTGGTGTATTGCCGTGGATATGACGAA
CCCAGTTGGATAGAGGAGGCAGATCTGAACTGTGGAGCAATACTCTATGCATTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATTCAGTCTC
ATGAAGAAGAGTAGGAAGGGGATACATGGATGTGAGTTGGTCATGTCGATGGGAGGATGACGAAGGGCCCACAGGAAGGGTGTGGGCCGGGAGGAGGAGG
GTCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAAGAGAGGGGTGGATTAGGGGGAAGGAGTGAATGTTTATGCATAAAAAGT
GACGTTTTACGTGCGAAGAGTCCCGCTTGATTTCGAGCGCGAGCTTTCGGGAGCCCGAACTATACTGACCCAATTGAGACTGGGTCGTAGGAGCTGGAGC
CGGATGAAATCCAAGGGTGGATCCAACCCGGATCCAGAAATTAGCCCAGCTCCAGGCGTATACTGAAAGTAGGGATCCAGCCCAAATCCAGGTGTACGCT
GAAACGGTGGATCTAGCCCAGATCCAGGTGTACGCTGAAAGGGGGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCTAGCCC