Description :
From Genome Similarity Track
Location :
Scaffold_3501:364- 1573
Sequence
1209 bases(100 bases per row)
GTAGCAGATCTTCAACAGCAAAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGATTCCTTTAGTACGCGACCGTGGAATCGTACG
GGGTGTAACTTGCCTTCGTTTTCTTGCATGAGCGTAGTCCTCAACGTCCATTCATTTGCAAAGAGCATGACATGAACTTCCTTCGACCGATCGAAGTGCC
TGAGGATGAGTGAATGTAAAACACTCGCCTTCAATTTATCGAAGGAACGACGTGCCACAGAAAGGCCACCCTCAACGGCAAAGTCTTCATCCTTAAGCAG
GTACAGCGCCGCACCGTAGACAGCAAAGTCTTGGATAAAGCGGCTGTATTAATTAACCGCTACAAAAAACGACTGCATGCCCTTCTTACTCGTCGGAAAC
GAAAGCTCGGTAATGGCCGCAAGCTTCTTCGGATCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGATAGTCCTCCTTGGGCTGGCAGAAAATGA
TTTTGGTGAAGCTAATACTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTATCGAAATCCTCGCCACCAAAGCAAAT
ATCATCCACAAACGATCATCGACCAAACACAGGTACCAGCGGTGATTCGTCTGGTTCCCCGTTCGTAAACATGCCAGCGACGGGGCTGTTGACGAGTTGT
AGTACAGGGTCGGCCTCCACCGGTGCTTCACGGTCTGCCGCGAGCTTTGTTTGAAACGAGCCCTCGGAGCTTGGTCCACGACGTTTCTTGGCCTGTTCTT
CAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTAAGGCTGGACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATAGATCATCG
GCGCGTTCTTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACAAACGCCGACACTTTACGTGCTCGCAAGGTCATCATGACCGC
CCAGAAGCCGCTTGCAGCATCCAGCGAGCAGATCGTCGACTAGCGGGCATTGCATACTTCATGATTGCGGTGATGGCATTCACCATCTTGTAATCGATGC
AGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATAACGATCGGTGATGCCCATGGAATGTCTGAAAAGACGATCAATCCTGCTCGCAACAAAGCGCG
GAGCAGCTC