Description :
From Genome Similarity Track
Location :
Scaffold_32:363989- 371932
Transcript NameFunction/comments
Physo_156979hypothetical protein
Physo_156980hypothetical protein

Sequence
7943 bases(100 bases per row)
CACCAAAACGATACGCTTCCATGGGAACTTGGTTCGAGTGTGCGTCATGAGTTGGTCGCTAATGTGGAGTAGCGGACATCGGACATCAGCGAGATGCACG
AGTACGGAGGAGCGCTCAATCACTCGCCACAACTGGCGCCACACCTCCAGGTTCCTTTCGTACAGATTGAGCTGTGCGCCGTCTTCACGACCCGTTGTCT
CCAGTTCGAGGTACTCGATCCACTCTTTGAAGGCTTCGTCGTCCACCTCGTTCAGCTCGTCTGGAGTCATATCCCGTGACCACTTTGGTTTCGTCAGGAT
GCGCGGCTGGTTGGCAGGGTCTTGTATACCGAACGCGTAAATTGACTGCGAGTTGCCTCGATCGGCCGCATACACAAGCTCGCGCGTTGCGTCCTTCTTC
CTGGCCTCAACGGCAGCCTTGGACTCCTTCTGGAAGATCGTGCGAAGATCAGCTCGCCCTGAAGATGCCTGTGCCAACGTGACGTTACAAGCCTAGCATA
GGTACTGATCGGCAGATCCACTACCTACCGGTTGGAAGGCAGGTGACGCCGGCACGCCCGATGCTTGGGCGTCGTCCTCATCAGCGTCGAGAGCGTCTCG
CGCGCGGTTCCTCGCACGCTTGTCCCGAAGCTACGAGTGGGCAATTGCAACAACACACAGCTGTTATGTACTTGTACCTCTTCGCCTTGCCGCTATAAAC
GGGTTCTTTCATGGCGATCGCGTCTGACCTGCTGCTTCTTGGCCTTGCCGCTGAACGGCTTCTTTCGCGGCGGCATGTTGGTGCAGGTGCACTTATTACA
GTATCTGAAGTGGAATGCGCACTCGTTACGGTACTTAATTTTATGAGATGGCTACATTTGAAAGAGGTGATGAATGGCTACAGCTTCTTGCGCGGCGTAG
CTGTCGCGTTGGCGTTGATGGTGGGCGTGAAGGTGCATTCGCGCATCTCGCGCTCCTGTCGCATGCGCTGGAGCCGCACGTTGCGCTTGCGGACGTAGTC
TGGGTCGTACAGTCGGCTGGAAACGTTCACGACGTCCGTCTTGGCCGACTGCATTGATGCTTCGGAGCCGATTGAGTCTCGCGACGAAATGGAGTCGCGG
CGGTTTGTGCGCGGTGTGAACGAGCAATTCAGTCTCTCGCTCCGGTCGCGCATGTTCTTCAACTTCTCCTCCCGGTTCTTGTAGAAGTCCGGCTGGTACA
GCCTCGAGAACACGGCGCCGCCGTCCGTGCGGATGCTCGAGCGCGACTTCTGGGAGCCGCAAACGGAGCCCGTGAAGTTCTGAGGCCTCGGCGTCGGCAG
CAGCGAGATATTCTCTCGAGTCAGAGCTGCTACGCGCGTGGGGCGCGGCACCGTGCGAGAGGAAGCAGGAGTCAACGTCTCTCGGCGTCTCGGCGGCGGC
GTCTTGAGTCCGCCCAAGCTCTCAAACTCGGCGCGCGCCATGGCGTTGACGTTCTTGTATGGCGACATGTTGCCCACATTGGTCGTGATCTTCCTGCCTG
AGTAGATCCCGGATCTTGACAGGGTGTCAGAGCCGCCGCTTGCTGTGCGAATCTTCTGCCTGTAGCGCGGCGGCGTGCGCTCGGTCGAAAATGAGTCGCG
CGCCGCATAGTCGTCCGCGAAGATGCTGGGGTCATCGTCGCCGAGGTCGCGCACTGCCTGCTGCAGCCGCGCCACCTCCTGCATGAGGTCGTACACCGTC
GGCAGCTCGCCCTCCTCGTCGTCTGCGTCCTCCGCGTCCATGTCGAGTCTGCGGCGCACAGGAGCAGGCGGCGGCGATGCCTCCCCTTCGGCTAGCACTG
GCGACGGCGCCTCCGCTGTGTCCACCGCTATCATGTCGGGGCGCCCGCAGCGAGTCTGATGGCGGGGAGCTCCGGAGCAGATCGATCCCCCAAGCCACGC
GCGCGCTGCCACTTCTCGGCTTTTGCGCTTGAACCCTTTCTTCGTGGTGTACCGTACATCGTTTGCACCATCACTCCTGATTTCGGACCTAAGCGGAGCC
CTTCCCGCGCCCCGCATTCGGCACTGGGCAAAGCAGACGCGCGTCAACAACCTCCTGGTGGCGATCGCTCAGCACTTCAGCAGCAGCAAGCCCGCGACCG
CCTACTGTACCCGCCGCCTACCGCCCCGTGCCAGTGTGGCGCGTCTCTGGTCTGCGCGAAGCCTCACCGGACCGCCAGACGCCGAAGACAGCAACAGCAG
CAGCAGCATGGCGACCCGCACGCAGACGCAGAAGACGGCGGCGTCGGGGGCCGAGACACCCACTTCCATCACGTGCCAACAACTGACGCCCCAGAGTGCC
AGCAACACGCCAGCTCGCGACATCGCCGAGGAGAGCAAGGGCGGCCAGCAGCCACGTGCGCACGGGAGCGAGTTGCGCTGCGTGCTCTGCGGTCTGGCTG
CCAGCTCTACCATTCGCCTCGTGCGCTGCAAGAGCTGCGGCAGCCACTTCCACGCGCACTGCGCTAACCTCCCGCTTCCGCCCGAGGAGGGAAACCTTTT
CTGTCGCCACGCGTGCTTCGCAGCGTTCAGCAAGCAGCAGGCCAAGGCCCCCGTGTTCAGGACCGGAGACTACCCCCGCCTCGCCACGCAGATCCAGAGC
GTGCTGCAGGAGAAGTCTGACCGGCTTCAAGTGAGACGCCAGCTCCCCCTGCAGGAGGTGGGCGCTGGAACGGGACGCGGACGCGGCCGTGGACGCGGAA
GAGGCAGGGGAAGAGGTCGAGGAAGAGGAAGAGGCAGGGGGAGAACTGCCGGGACCAATCGATCTCTGGACGATTCCGATGACGAAGCCAGCCAAGGAAA
TCCGCGTCTCTCCTCAATTGATGGGGAGCAAGCTGAAAGCCCTCAGGTACCCAATGACGCCGAGCCGTACACTCCAAGGAGTGCGAGCGGTGGTATGATG
CACTCGAGTAATAGTAACAGCAACACGCCGCGTCTCGGCGAGGAGGACGGGAACATGCAACCATCCTCGCGTACTGCGTCCCCTGCGTCCCGAAGGCCGT
TGCGAGGATTCGACACGGAGCAAGACAGCCACTTCCGCAGCGCCCCTCCGCCCAACCTACCTGCGTCTTCCTTGCAGATGCCTCGGCAGACCCGAGGCGA
ATACTCTTCCGCCCCAGCGCCTGACCAAGCAGGCGCTGACGGACCTCGACAGCACCACAGTTTTTCGGTATCGGCGCAGCCATATCCGATCGCTGGTCCG
CGTCAGCAACAGTCGGAAGACCCGCGATCACTTCAATCGCCTTCAACGTTCAACTCGACGCCTCAGTTCTTCGATGGTCGCTCGTCCGGGCGTGTACCGT
CAGCACAACCTGGGGCACCGGGCATGCAGCCACCACAGCAGCAAATGCAGGAACATGGAGCTCCTCTTCGACGTGGTGAATTCGATCCTGCCTATCGTGG
TGGGGCGCCAACAGGCCCGATGCCTCCTCAAGCTCCCTATGGCGACGCCCAGAGTGGTGACGTAGCATCAGGCCAAGCTCCAGGCTTCAAGGATGCCCCC
GCGAACACATACCCTCCTCAAGGTCAATTCCCGCCCCAGGCGCCGTCACAGCTCCCCATACGCCGACATACACCGAACATTCCGTGGCGCAATCCTGCAG
CGTTCCCTGCAGAGATTTATGAGCGCTTTAGCTGCCACTCCGACGATGCCAACCACGTGTTCCGGATCGACCTTACACCTGTCTTTGACGATAAGGCGAC
GAAGCTGTACCAAACCGAGATCGACTTTTTCTTCCGATGCTTCGAGTCGCCTGATGTGAGCCTTGTTGTGAAAGGCATGAGCAGCGAGCTCAACCAGTAT
ATCTGGGCGTGGCCATTCATCCTCGAGTGCTGCGGTAACGACACGCATTTCGCATTCGACCACTTCCAGTTCAAGCGAAATTCCGAGACGGATATGCCTG
AACTTGCTTACGTTGGAGAGCTGCAGCTGTCCATGGCATCGTTCAACTCGTATCTCGAGAAGTATTTATCGAATGTACCTGGAAAGGACGTCATTGTGCT
GGAAGACCATGTCACGAAAAAGACAGTGACTATCGTGGCGTCCGAAAATATTATTGCGCTTAACAATTTGGTGCTCGCTAAGCACTGCGCGCAGGTATGT
ATAGTTTTATACTGTGCTGACCGGATTCGCTTCGCTAACCCTTGTTGTGATTCATTGCTTTTCTAGCTCTATAACGACCTCATCAAGGGCTTTCAGTGGG
ATGTTTTTGCTGGCGGCATTCACTGCTTGCTGCAGTACCTCCCGCAAAGTAGCTGGCATGAAAAGTTTTCCAGTCCACGACTGCATTTCAATTTCCCTGG
GGCACGAGGTTCGCTGATGGATCCAGGCAATGGTACTACTGATACCGCTTACCAGGTACGATATTACCGGTGCGGTGGATATCGTTATATTATATTTCTT
ATGTTGTGACTTTCCCAACATGCAGGTCCTTGTGGGGTCGTTGGAGTTGGTCATTTTCGAGCGCTTTGAACCTCAGTACAAGGCCGATTTCGATCTCATT
TTACAACGCGCGGGGTACGACGCTGACAGGAAGACTATGCTACTAGATGCTCATCTTCGTGCTCTGAGGTAAGCATCATTGTGAAAATTGTCTGCATGAC
TCGGGGATTATGACTCAATAACGCTTATTTATGTGCAATCTCTCTTTACAGAGCCGCTGGTTTTGCTTTTTCAACCGTGCTTCTTCAGGACGGAGAGTTT
GTGCACGTCAACAAGGTGCGTTGGTGACGATAATGTATATAGCTAACTGGAAATGCTTCTGTGTGCTATCGTTGAAAACACCACTAATCGACGGTGAATT
TGTTTCGGTGGCTTTGCAGGGGCGCCAACATTTCTGGCGCGTTGTAGAAAAAGACAGCGTTAGCGGTTCCATTAACGCACCTTGCGTATTCCTCTCGTGG
GAGTGGGTCTACCAAGGTGTTTCGCAGCGCGGTATCTCTACTGAATGCTGGGTACGCGTCGGCTAAATCCTGTTTGCTACTGCGTTGTGGCTGAATCTAA
CGGCTTTTTTGTTTGCGTTTTTGCTCAGTTTGCAATGAAGAACGCTAGCGTGTGCCCGGATGGATGGGTTTTCGACCCTCGCCGTGCGATTGTTGAAGCT
GCTAAGGTGCGTTCGCTGCTATGGTGATGAAATGATCCGCAAATTATCTAACGTGCATGTTTTGATACCATTGCAGTGCGGCGTGGCAATTGTGCGCATG
GGTCAGTTCTTGCGCACAGCATTGGCGTCAGGGCGTCCGCGGACATCGCAAATGCTATCGTTTACGTCTGTCCCCGCGCCTATTGACCGCGGTGTTGTGG
CTCAGCGCCAAGCCCAGATGGTCCTCTTTCTGGAATCGATTCTGCCGTGCCTGGACGCTATTGTTGAGGAGGCGTACGAGCTAGGTCTGTCCAGCACGGA
CGACAGCGACGAGTTCCGCAAGGTTTTTGATGACGAGAGCATGTGGCGGACGGTAGATGCCGACTTGCGCGACCCACCTAGTGACAACGCGGAGAACTAC
TCGTGCGGCATTTGTGGACGAGAGATCACCAACCTGTATAAGCAGTGTCTAGGCTGTGCTATGTACTCCCGCCGATGCCGCCCCAACATGGCGTATCCAG
TCTTCCGCATTTGTCTGCGTTGCCATTCGCAGCCGGACCAGCACCACTTTAAGCCACGCGCCATCGCTTCGTACTACGACAAGGTGCTGAGCTCAGAGGG
GCACACGGGCCTGCTGCCAGCCACACGCCGCTACCAGTCAGTACGCAGCTACTTCAAGTGCCGGTGTGTGCCGTCTCTCCGCTGCGCGCACTGCGGCGGG
TGCGAGTCGTGCAGCTGCCTGTGCCACACGTTGTTCCAGACCCGCTTCCGCTTCACTGCTCCCGGTGCGTATCATGCTTGGTTTCCTGTATATTTTCCCT
TGTTATCCAAACATGGGTGGCTGCGCGGTGCTGGGGTTTGCTCGGCCGGACTGCAGCACCCCATGCACATTACCACCGCTTTTGTTGAGTGAAGTAGCTA
ACCAACGGTGTTGCGTTGTGCTGTCTTGCCTTGCATTTTGTGTGCCTGCACAGCGAACCTGGAGCGACTGCGTGCGGACGTGGACGCCGTCGTCAAGTAC
CATCAGCAGCAACTGCAGCAGCAGCAGCAGCAACAGCAGCAGCATCAGCAACGATAGCTCAGCTAGGCGCCTTTTGTTCACTAGTTTGCCGGCGACGCGC
GCGTGCGGTGGACGAATACAGCAGTATCCCTTCTCAGACGAGCATGACTCGGCTCTGCGCGTGCTGCTTGGTGCCGCCCGCGGCATCGCTCGCTCACTCG
CTCGCCCAGCGCGCGGCCCTAAGATGAAGCGTTTGTGACCCGACCCTCCCTCCCACCCGCCTTCACCCATCATTACCTCCCGAGTTTACAGCCGTGTTTG
TTTATCCTCGTCTCTGCTGTGAGCCCCATCTGGCGCCAAGTTGGCCAGCGGCCCTGGGCCAGTGGCCCATGCGGCGATACAGGATGCAGAGCGACCCGCC
AACCGACGAGCAATCAACCTTGGCGGCGCAGCGTGTGCTCCTCTCGCCGCGTCTTTGGTGCGTTCCGGTCCAGCGCGCCCTGCTGGTCATTTTCTCAGTG
GCAGCGGCGGCAGTGCGTGCGCTCGACTCGCCGTCGGTGACCCGCGCTGGAGGCCCGCGCTGTCCGACGCATCGCCTTGCGGTGCTGCTCGGTGTGGCGC
CGCTTTGGTGCTTGGTGTTGCTGCTGGACGGCGGGATCCTATTGCGCACTTCTTCGCGTGCTTTTTTGCTTTTTTCTGCACGGATTTTCTTTAGAAAGCA
GCTTTTTAGGATCGTGTCGGCGGTGCATACAAAGCGCGAGTGAGTGCGCCGACCGCTTTTTCGGCGGTGTGCCTCGCGTTCTTTGCGGCCGCCGAGTCGT
GGCCTCGCGATTGAAGCGTTTCCGCAGTCCTTGAAGTTTTGCATGTTCAACTGGACTGGAACTCGCGCACGCCCCAGATTTGACGGCCCCCGGCTTGAAG
GCTGGCTGGCAGGCTGGCTCAAGAGGTTGAGGCCCGCCAGGTCACATGCTGCCTCAGCGCATGCGCGGCGATCCTCCAATCCCCGCCCAGCGCTCGCTGC
CTGTCGTGCGTCGGCGCCGAAAGTGCCCGTGTTGAAGAAGCCCGACACGGAACGGAGCAGACTGCCGAGCTGGCTGGCGGCAGTCTCGTCAGGATTCCTG
ACTCAGGAAGCGCTTGGGTTCTCGAGCGCTTAGAGCGAGCGAGCGGACGGCCAAGAGCAGCAGGAAGCGACTCCGCAAAGATTCTGTTGCCAGGCGCCCG
AGTTCCAGGGAAGCAGAGTCTCTGTTGCGCCACGGATGCGCGGCGCTCTCGCTGGCAGAGCAGCGAAGGCGCTCTCTTTAACCGAGGCTCCAGCGAGGCC
AGTGGAGTGTCGGCGGATCGATGATGGCGCTGGCAGCCTCGGGTCTCGGCTGCACTGCACTGCCTGCAGCGATCGTGCGTCCAGCCTGCGGCGAAGGCTC
GCCGCCATGCGATGCCCGTGCCTGGGAGCGGCTTTGCCAAGTAAAAAATGTGAGTTCGCCAAAAACGCGCTTTCTTTATCCTTTGACGGCTCCTTCAACT
GACCCGATCACAGCCATAAACGAGGCATCCTAGGCGCCCCGTCGCTGCGCGCCTCGAAAAGCCAGCGGTCGCCGCCACTCGCTTCCAGCGCTGGCGGAAC
GCTCGAGGCTCAGTCGAAAAGTTTCCTCCTCGAATGCAAAGCGGTCGGAGAACGTCCAGCCCCGAGTCCTGCCGCCCCTCCAGCTTCCCCCCAGCCTGTC
CGGAAGCCGCCGCCGCCTGCCGATTTCTTCGCCGCGGCCTGCCCGTGTTATCTTCGTGTCGAGTGCCGTTCGAGCGCGTCTGGGACTGAGCGCGCTGCTG
CCCCCGTGTTTGTCCACCCAACTAAACCACCACCACCATCACC