Description :
From Genome Similarity Track
Location :
Scaffold_4:363976- 372055
Transcript NameFunction/comments
Physo_262546Eukaryotic/viral aspartic protease

Sequence
8079 bases(100 bases per row)
CAGCTCGAGCGACATCGACCGAGCCTTCACTGACCCTGGGGTCGTCGTCGTAGCCATGTACATCGGGTGACGAGTACTCATCATCCAACGGAGCTTGTTG
ATGTCCTTCTGGCCATGGCGGTGCATCCGGTGGCCTCGGCAGGATCTTTCGCGGCGTCGGGTAAGTTCGGCGCTCGACCGCAGGCGGCTGTTCAGCCAAC
CATTGCTCGTAGAGACGACGTTCTCGTCCTTGCAGAGTCTCATCACGACTCGTTGAATAGGCCAACACCTGCCACTCTTTGTACTTGTTAGAGTCCAACC
TCGCGTAGCCGGTTTCTCGCGGTGGTTCACTATGCGGTACCCACAGCACCACGGAGTCATGCTTGGCGCAGTGTCGTAATATTGGTGAGCCGTATCCACG
TCGGCTGCCCCCGTCGAAACCTCGTTATGGTCGGCACGAGCTTGCCCGTGCGTCGTACCCACACATCGTACTCCGAACGAGGTAGCCGCTGGCGCGGCAG
TCGAAACTCTCGCCACTCGCGACCGGGTACGTATAAATCCTCGATCGGCCCACACGAAGGCTGCGTGCCGTAAGGTTCGTCATCTTCAGCACTCTGCGAC
TTTAGCAGTGGTACCATGACCTCGTCCGGAAGGCGTGCGGTGCCATGAAATAGATCCAGCCGGATTCCAGCCGGGATCATGAAGTCCATCCCAAGGATCA
CATCCACCCCGGCACTGTGATCCATTATCCACATTTCAAATTCGTAGACCTGCTCCCACCCGAGGGTGATCTTGACGAGCGCCCGTCGCCGGGTCTCCAT
CACCCCTGGGTTGATGCAGCGGACTTCGAGACTTCGTCCGTGGTCCCGGACTTCTCGCACACGTAGCCGCTTGGCGAAGCTGGCAGAAATCACACTAACA
TTCGCTCCAGTGTCAAGGAGTATCCTCGTTCGCGCGTCGTCCACTGCACCATTGACCAAAGCCCTCATTCGCTTCCTCTTGTCGTATCGTTGGGACGACC
ACCACCCCGTCTCTCACCGGGCAGTAATTTCACCGCCCAAACGAGGTTCCGAGGTGGCCCCCTTATCTGGGCTAAACTTGTGATCAAAGCCTCGGTCGGG
TGTCCATCACGTTCATCATCATCATCTTCATCAATACCAATCGCAACGAGACTTGCGTCCCGGTTCTCTCCATTTTCCGTCGGTTTCACACGTTCATTGT
TCTTCAGGGCGTCAGGCCGTTTGCTTTCGCCCGTGAACGCGAACAGATAGTCCGCATCAACAGCAGGCTCAGCTAACTGTGGCAGCCCGATTGGGACCAA
CCCAGTTTCAGTTGGCGGGCTGTCTAGTTTAAATGGCTTCCATCCACCAGGCTTTGCAGCTCTGGTGACAGATCCTTCTTGTCGACCTTGGACTTCAGGA
GCTTGGTGAGCTCGTGGAGTGCTTCACACTTCCCAGCGTCGTGCACCTGTTTGCACAGTTTGCACCGCCGGCAGCAGAAGTGCACCGAGTGGGACGGGCT
TCCGCACGCGGCACACGGCCCATAGCGTCGACCATCTCGTCCACGGTTGGACGGGCCTCCTTCGTTCCTGAAGCGTCGGTTATCAGACCGAGCGAACGTT
CCTTCGGCTGCGGCCCTGCGCTCAGCATCGTTAGCAGCAGCGACATGTCCGGTAGACCCATCCGAGTCGTAATCAGCGTCTGAATCCTGGTCCGAGCGTT
GGTCGGCCGAGTATTGGCGCTCATCCTCGAAGTAATCCTCGTTCGCCTCAGCATCACGTCGGGGGGCGTATGGAGCCTCGTTGCGTGCACCGACCGAGCC
TCCGACGTTCCATTCCGCCATCACATCGGCCAGCGCGTCAACCAAAGTGACTCGGGACTGGTACGGCGATCCATCGCGTCGGTCACGGCGACGGTCGTCT
TCACTGTGGTCGTTGCTGCGGTCGCTGTCACGGCGACGTCGTTCGCTACGGTCTTCGTCGTGGTAGCGTTGTTCGCGGCGGTAGCCACCACGAGAATCCT
CGTTCGACCTCGCATCGCGTCGACGTCCATCATCTTGACTCCGAGAGCGGCGGAACGACTCTCGGTTCGATTTGCGGTCACGGTGACGCAGGATGTCGTT
GATCATGTCTTCGAGGTCATGGATGCTCTTGACCCGGACGTGGCACAGACGGTCTTCTAAGTTTCGGTCGTCACACGTGACCAAGAAGTGGTCCACGTGG
TCCTTCGCGTCACGACCACCGTCGTTGCGAGCGTAGCCGTTGAGCCGGTTGAGGTAGTCACAAACGTGTTCATTGTCTTCCCGCTTGGCCGAGTAGTACC
GAGCCTTCGCGGACTGGGAAAACTTCGAGCAATAGTACTTGATGAACGCCTCGCTCAGCAACTTCCACGTGCGTCTTGTCTTGCGTGGGAGCTGGCGACA
CCCGTGCATGGCTCCATCCCTGAGCTTAAGTTCGATCGGCATACACCACCCGTTGGGTGGTGCATGCGTTCCCTTCATCTCATAGATGAACGTTCGGAGC
CACTGCATGGAGTGCTCGCTCTTGTCGCGCGTTCCGTAGAACGGCTTGATGTTGGCGAGAGGCAAATGCGTGGCGATCTCGAGCGTTGGGGTTGAGCTCT
GGTTGTCGGTCGCCCTTAGCTCGCGCACCTGACGTGCCCATTCGCTCGGTAGGTCCCCTTCGTAGTAGTCGGGCCCGTGGTCGTCGTCGCTGTCCGACGA
ATCATCTTGGAGGTCGTAACGTCGGCCGGACCGACGACCGGTCGCTCCGCGCGTGCCAGGCGTGGCGAATGAAGCCTCGTTCTCCCTAGCCAGACGTTCA
CTACGGTCCGTAGATCGTGGAGTTACCATGTGCGCGTCTTGCATGTACGGCGAAGCCTCGCCCTTGACTGCGAAGACTCCGTCATCCGTGGCTGCCTTCC
GAGGGGTCGCTGGTAGCGGGACCTTGGCGGGGTCAACCGCTCCCGGGACCGAACGAAGCTTCGTTGAGCCTCGGTCTGCCACCCCAAGGCCTCACTTAAC
TTCTTCCTCCACTTGGTAAGAGCCTTAGCGCCGGTGGTTGGCGTCCAGCTCGCGAGAGCAGCTTCCGTCGGGAGGATCTGAGGTTCGCACCCCATCGCCC
GCAGGAGGTCCACAGTGTTCTGAGCGACCTGCCGAGTACTCGTTGAGTAGATCGGTGTTGCCAAAGCCCCTCCGAGGTCCATTCAGATGGCCTGGCGGAC
CTGCTTCGGGGAGAACAACTGCATCCACTCGCTCTTGGTCTTCATCAGCTCCAGGCATCGGCCTAGAACCTTGTTGGCCGCCGGGGTATCGCCGTTGATG
GGAGGACGAGTGCCAACCGGCTTGGAGGTTGCCTATCGTCACCGAGGCTCTGAAACCCTCGGTCGCACCGTCATCCGCGTCATAGGCGGGCTCGGGGCCC
GGCATGTCGTTGAACGTTTCGGAGAGGTCGCGGGTGATCGACCTCGATCCTCCACTGCGGCACGCCGACACAACCGCAGCTTCCGAAGTCTCGGACGTCA
CAGTCCTGACATCCCAGTCATCGTCTTCATCATCTTCCTTGGCGTCCGAGGAATCAATCGCCGTGTCGTAGCTCACCGAGCGCTCGTCGATCGACTCAAT
CCGATCCGTCGCTGGGGTCGAGAACGAACTCCCGGAGAACATCGAAGCCTCGTTGCGCGTTCCACTCGACTTCACCGGCGTCGCTGGTACCGCTGACTTG
ACTCCTTTCGCCATCTTCACACGTCTTCTTCATCTCTTCTCTTCTCTTCTTCTTCTCCTCTTTGCTTGTTGGGGTAAGACCTACAACAACCCAGACACAC
CGAAGGTCGCACCAATCCCGGGTCGCGGCACCAGTTGTGGTGTGGTAATTCCACTAAAATTCTCCTCTACCAAAAGGCATTAGAGACACCAACAACACGC
TAACCCGCAAAGGTAAGCGCTTATTGGATCAAAACCTGAAGACCAGGACCGATCCCTTACACCGGGTCGGTTGCAAGCGCCTCTGTGCACCTTAGGTTGT
CTTCGGTCAACCCAAAAAAACCTGTACCACTAGCCACGAGCTTAGGCTAGGATACTATGTAGCGCTTTCGCGCAACCCCACTACAGTCCCTCAGAAAGGA
AGGGTACCGGCGTGTTAGGCCTTAAACAGGGGGACCAAGGTAAAACCTCGGTAGGTAGGCTAATACACTCAGGGACACTCTAATCCCACAAATATATACT
GAACGATACTCTAATACCGTTCCTGCCTCTCCGGCCACGCCAACTCTTGGCGCTGCCAAGGAAACTCTCGGTCAATGCACGATAAGCTCATCCACACGCA
GCCGAGCGTGTCCAGGCACTACAATATGCTAGCTACACTTACCAAAGTCGGACTTGACCCTTGTTGGCTTTGGGGGAAGACTGTCTTTTTATTACTGAGT
TTTCTGAGGCCCTGGGGGCCTCGTTCTGGCCATCCTATGATGAGTCCTATGTCCCTATACAAATATCTAGTGTGAACGATCGCAATAAGGCGATTCCGGA
CACATCAAATGACGACCGCGGCTACACTAATAAGTGCGGCCGAAGTACGTAACTAAATGCATCTGTACCTAAAAGTGGGTACCATGAAGCCTCGTTCGGG
GTTCTATTAGGACCCGACGAGGCTTCGGCCACTGCCTGTCACTCTACCGAGGATAATGTCATCATCCAATCAGATGCAGCCATCTCCGTCTCTCGCCTTG
ATCGCCCCTTGATTGAACTTGATTGTCGGGCTGGCGGGTCAACGGCATTGGAAACTGCCACTTTCCAAATACCACATTCCGTCAAACATCCTTCGCGAAC
GAGTCAATCCACATCGCATGGACTTCTCTGAGAACTCACATGATCTCACGCCATAAAGCGTTTTGGTTTTTCGGCCGCAAACAGCCTCCCGCACGATCCG
CCTCGGAGCTTCGCTCTTCTGCACTGCGTGCCTCTGACTGCTCGCGAGCGCCGGCGCCCGCGCGCACACCCTCGACGCCTTCCAGGCTCCCGGTGTCTGA
GTACTTCGCGGCACATCGCCTGAAGCACAGGGAGAAAGTGCATCATAAAGATTGCGAAAAATCAACAAGCGAGATACCCCCATCCCCATCCAAACCACTA
TCATCTGCATGTGTGTGCACATTCTGAGTGACATGAAACTAGCACATAAGCACTGTGGTTTCAGGTAGCACAGCAGCACACGCGCTTGTCAGCATTTATT
ATGACAAAGTCAGGCTTGAAGCGGACCTGAAACTCGCTAAAAATCACACGCTTCAGAAACCCTAGACACCACCAGATGTCGACGCATCTACGCTGAGATG
CGCAGTAGTAAACAATTGATAAGAATCGACCAGCACAATCCGAGATACCCGCAACAAAAAACAGGATACTTCTGCTTCACCGCACCATGCGTACTATCCA
AATGAACCAAAGCAGTGAGATCATAATCATTAGCCAATACGAAAAGAATCCACCTCCGATCCTGTCCCCAACAATGGTAGCCTAATGCCGTCCTCATCAT
TCGAATCACAAAACACGAGCACATACACAGGGGATCAACTTAAACCTTCACGATCGTACATTGAGCGCATACAAATCTCCATGACTGGAGCCATGCTGTC
CGGCTTGTTTACGCACACCACGACTTCACATTGTTTTGCACCTTCTCGAGATCTGGAGCTGACCCTGCGATTCGGTGCTTACAAACCTCGCGTGACACAA
AGCAGTATGCTAATTGAGCCACCATAGATGGCATTTCCTCAAGCTTAGCATTTAAATACTCCTTCATAGCCGTAGAAAACTTGGTGCTAACCGGAGACGG
TGGCGCATCGTCAGCCATTGTATGCTCCTATTGCAAAAATAAAATCTTAAAATCCACGACCTGGACCTCTGGAATTCCCTGGCATTCGAGGGCCTTGTAG
CAGCAGGAACAGGCTTCACCGGACGTCTCACTGCGCTTGGATTTCAGTTGGTCATCCAGCACCACATATCATGGCGTGTTAAAGCCAGCGAGCCTTCATC
ACGGTCGACTGGTTCATCGTACAGCGCACTAGATTTTTTTTTGGTAAACGTTGGTAAGCCCGCCTCAAACTCTTCGTAGGGGGTGGCGGCCCCTGTACGC
CGGAGCTCGAGCTCGAGCCAAGGACACTGCTCTCGCCGGCCCTGTGTACTCTTTGCCATGGTGGTGGCAAAAAAGCGGCGGATATCGAGATACTTAGCCC
TATCTTATTTATTATTGGAATCTTATTGATATGGCATTAGTGATACGTTAATTTCAGTATTGTTGTAATCCACGGCTTTGGTGACAAGTGAAGTATAATA
TAATAACAGTGCCCACCGCCTATTTTTATGTAAGCGTACTGTATCTCGGGATTGGTGCAAACTACCCTAATTATTAGTGCGTGCTTCCATCAGAAATTAC
TCCACTCCCATATGCCCGGCGTTTTGTGAGGTCCTCAGGGTGGGTTAAGTCGTCACTAAACTTCGCAAGCGATTGTTAGCAGAGCTCCAATCTGTCGGGT
CTCTGCTCATGGACCACGCGTTTGTATCTAGTGTTATTAGCGATTGCAGGCTCGAAAGTATTCCGCGTCAAGCTCGATCCCTGTTTTTTATCTTTGGGCT
CTTTCGGAGTGCACGCGGAGAAGATACATGGGCAGATTTTTTTCTACTATCGGTCAGTGGGTCGTGAATCTTGGAAATGACCCAGCACCCTTCGAATGTG
CTGGGGTTGGATTTACGGGTGATTCGTTTGTCAAACGGCCCATGGATGTCGTCTTCAAAATGAAGGGGTCCGGATTCACGACGCAGAAAATGATAGTTCA
TCTCAAGGGAATCCTAGCCGGTGTGCCTCACGACAAAACCAAGCTTTCACACGCAGATACGGTTTTGCAAAATGGTTTCGCGACTTCTAAGCTTCGCGTT
TACTGCCACGTGGACCCGAATTGCAAGAAGGATCCTAGGTCTTATTCCTCTGATACGTTGGAGTTCAGACAGCTTGCCACGTGAAAACAAACAACCGACA
TGTCTGTTTCAAGGCGGAGGATACGTGGAATGCGAAGAATGGCCTTACTCGCTTGACGGGGTCAGAACGCAGTGTACGAGTCCAGCGAACGGAGCGTGCA
GTGGAGAAAATGCGAAAAAAATCGCTCCAGTAAACGCGTCGGTACAAAAAGGGTAAAGAATGAGAGAATTCGTGTTCTCGAGATGATGATGGGCGCGAGC
GCAGCCTCTGCTTGTTGCCCTATGATCGCTGAACGACGCGTCTACTCCTTATTAGACAAAAGCCAAGGCAAAACTCACCCCTCTTTTTATGCCCCCCCCC
CCCCTCAAGCATATCACCAGTTAGGCACCTACATACTTGATTCTTTTTCCTTATTGGCATAATGCAACATTCCAGCAGAGCTTGTTGAGACCTCTTTTAG
AAACTTACGGAATCATTTTGACATGTCTCATGAGACAAGTCAACTATGGTGATTTGTAAGAGGCCCTGCAGTGCACATCACTTCATATTGGTAGGTTAAA
TTATAACATGATGACTACTCGATGTACTTTTATTTAGTACACATGAACGTACATTCTATGTTGAACCTATGTGAAAGAGCGCTGAGAACATTTTTTCAGG
TGAGATGCACCCATAGTGTTTTGTAAAAAGCAAAAAAAGTGTCTCTACAGCACAAGGTAACCAGATCCTCTCTTTCCTGGAGCGGGAAAGAGCGGGTCGC
GCGTACAACGATGTCAGCGTGTATGGTTCGGACTTGTGAGCATAAAATGACTTTAAACGCAACAAACCCTCTGCTCCATTGACAACAACGACTGTTAATC
ATGCAGTTTATTACTACGCCAGGAAGGATCGATATCTCAACGTAAAAGCTACCACTGTGCTTTCTCACTTTCTAGGGTTGATCCATTCTACCGTTGATAC
TGAAAGTAGAGGAGCTCCTCTTCAGCTTCGACGTCTGCCGTCTTGCTTCTCCTCTGCGTCTTGATCCACTGTCATAGAGCTAGGATTGAGGATGGAAGTG
ATGATATCCTTACCGATCGATTTGCGAAGCTCCACAGTTGCCCACGCGGCTATGTAGTTGGGGATACCTCATTCTTCTA