Description :
From Genome Similarity Track
Location :
Scaffold_13:363889- 372086
Sequence
8197 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGATCGACTTCTCTCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCTGGCATCTTCGG
GATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCAGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCG
TGCTAAGAGTTGGGTGTACACACGGGAAGCAACCTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTCAGCGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAG
CACTCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCTTTGTCGGCT
CCCGGCCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCA
AGCGCGACTGTCCTGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGC
TGGAAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTC
TTCGCACTCTCGAATCGGCGAAGAGCAGCTGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCGGG
GGCGTCGAAGAATTTCGCACGCCGCCCGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTG
CGACTGGCCGACGAAAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAATTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCG
ATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGAGTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGC
GCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATTCGGCAGATGCTTG
GGAGTTGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAATTTAGGTCCACAGGCGGGTA
ACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCCCTCACGGTCGCCCAGACCTTAACTGA
AGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGT
GTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCAACGACATCCCTAGACGTGGGCAGCAAAGCCCGACGTCACGGTCGCCGTC
GTCAACGACGCCGCCGCCGCCTCAAGGCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGCGTCCAGGGCCCGGGCTCCTCCGACAAG
GCCGGCGGAAGAGCGTTATCACATCTTAGATGGCGAGACTGGTTTACCCGTCAATGCATCTGGTATCCACTTGGAACCGCTGCCAGAGGTTGCAGAGATA
CTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTCCTCATGAGACCTGAGACCACTCAGGAGG
AGCTGAACGCCTCCTCTTTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAATGA
TCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTC
GTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCA
TGGTGCGGGAGTCGAGATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAA
CGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGCACAGTGCGCTGGATTTGGTAGACGGA
TACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGT
CTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCG
TGCCGAAGGAGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTGATGTGAGCGAACAAGCTCTACGCCAACATCGACAAG
TGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGATCAAGGCCATAGCAGCATGGC
CGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTTACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTC
GGGCCTCCTTCAGAAGGATGTCGACTGGCACTGGGAGAAGGAGCACCAGGATGATTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCC
CTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCGGCGATGCCTCCTATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGATCGAG
TCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCG
TGTTCACCTTCTGGGCTCTAGGTCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTCACTCGCCTCACCTCTCCCACAGGATGGCGAGG
TGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGT
TGGCCCACATCACGCGGGTGACAATGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATAAAGCTGTCACGCCTATCGTCAAGTTCCTTATGGC
CGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTTAAAGAGGGTATCCTTTATTAACGGGTGGAGACC
ACTGATCCTCCACAGGTGGTCGTACCCAACGACGAGGATCTGAAATTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCTGCCACTTGAGCCGCG
AGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGATCGCCCGGTATGTCAAGACATGTGAAACATGTCAGCGGGTCAA
ACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGAC
GGACACGGCAACACCGGGATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAA
GGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGCTTTGGAAAGCGCTGTT
CCCTTTGCTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGC
AGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGT
TCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTTTTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTC
CTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGCGGAATCCTTTATTGATATCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATG
GCAGCGGCCCAAGATAAACAAAACGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGCGGTTGGGGACTTAGTGTTGCTAGACACGAGGA
GCCTACCTCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCCGACATGGTGCGTCGTACAC
CATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCAC
CTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAG
ACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGGGTGT
GCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCA
GGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGGCGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCTAGT
CCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCCGTTGGAGCAATCGGACGAGAG
TGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCTCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCAGATCCTC
CAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCATGGGAGCCGATTGAACGGCTCCTGATTG
ACTGCCCGAAGGCTATCGCAATCTGGGAACAGAAGCGGCGACAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATT
CCGTACCCGCGCTCATCGGGAGCGCTAGAAGCCGCGCGCTTCAGGATTTTCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTTACACGAAGAT
CACGCTGGTCCAGGATACGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCCCCACCCATGCTCAGAACATGTC
CCCACAAGAACTCCACGTGGGACAGTTTTCGGACATAACCCGGGGGTATCCTTAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTC
GTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCTCGTT
CATTGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAATCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATA
CCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGG
TCATTCGAGACCTCCCGGGGCTCAACGATAGCTCCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGA
AGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAAAGGCCTTATCACGCGCAAG
ACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCGGAGCGCACA
GACGCTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATATTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCG
CAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTCGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAAGATGA
GGACGACGGACTGCGGCGCTTGCTTGCTCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGAGGC
TTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTATCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACG
GTCGAATAGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACCGTGAAGTGAGCCTCCGCCGCGCACGCGCGGCCAAGTCGATGGTTT
TCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCCTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCT
AAGTGTACCCTGGTTACATGAGGTGTGACACTTCACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAG
CCAACCATTGGTCAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCATACTTAACCTACCTATAAATATACTCAGTTTACAATCTA
CCTTATTTAGGTCACTTCGCTCTCGTACGCGCTACTGTGTGGCAACCTTCCGTTCGATGACGAGAGTATCCCCAACCTGTTTAAAAAAATCTGCGGTGGC
ATGTACTCGCTGCCCAGCCACCTGTCCGAGATGGCGCGCGACCTCATCCCGCGCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTG
TATACTCTCGGAGGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAAAATACCACAAACTGATACAAAATGCCACAATCCGTATACAA