Description :
From Genome Similarity Track
Location :
Scaffold_32:363858- 365274
Transcript NameFunction/comments
Physo_156979hypothetical protein

Sequence
1416 bases(100 bases per row)
AAGGTGGCATTGCTCTCGCCGACGCGGTCGCGACTGTACGCCAACACGGGGATATCTTGTCCGTACCGAGCTTGCAAATACGCCGACCACCTCTGAGCAC
GCTCCTCCGCCACTAAATCAGTCTTCGTTAGCACCAAAACGATACGCTTCCATGGGAACTTGGTTCGAGTGTGCGTCATGAGTTGGTCGCTAATGTGGAG
TAGCGGACATCGGACATCAGCGAGATGCACGAGTACGGAGGAGCGCTCAATCACTCGCCACAACTGGCGCCACACCTCCAGGTTCCTTTCGTACAGATTG
AGCTGTGCGCCGTCTTCACGACCCGTTGTCTCCAGTTCGAGGTACTCGATCCACTCTTTGAAGGCTTCGTCGTCCACCTCGTTCAGCTCGTCTGGAGTCA
TATCCCGTGACCACTTTGGTTTCGTCAGGATGCGCGGCTGGTTGGCAGGGTCTTGTATACCGAACGCGTAAATTGACTGCGAGTTGCCTCGATCGGCCGC
ATACACAAGCTCGCGCGTTGCGTCCTTCTTCCTGGCCTCAACGGCAGCCTTGGACTCCTTCTGGAAGATCGTGCGAAGATCAGCTCGCCCTGAAGATGCC
TGTGCCAACGTGACGTTACAAGCCTAGCATAGGTACTGATCGGCAGATCCACTACCTACCGGTTGGAAGGCAGGTGACGCCGGCACGCCCGATGCTTGGG
CGTCGTCCTCATCAGCGTCGAGAGCGTCTCGCGCGCGGTTCCTCGCACGCTTGTCCCGAAGCTACGAGTGGGCAATTGCAACAACACACAGCTGTTATGT
ACTTGTACCTCTTCGCCTTGCCGCTATAAACGGGTTCTTTCATGGCGATCGCGTCTGACCTGCTGCTTCTTGGCCTTGCCGCTGAACGGCTTCTTTCGCG
GCGGCATGTTGGTGCAGGTGCACTTATTACAGTATCTGAAGTGGAATGCGCACTCGTTACGGTACTTAATTTTATGAGATGGCTACATTTGAAAGAGGTG
ATGAATGGCTACAGCTTCTTGCGCGGCGTAGCTGTCGCGTTGGCGTTGATGGTGGGCGTGAAGGTGCATTCGCGCATCTCGCGCTCCTGTCGCATGCGCT
GGAGCCGCACGTTGCGCTTGCGGACGTAGTCTGGGTCGTACAGTCGGCTGGAAACGTTCACGACGTCCGTCTTGGCCGACTGCATTGATGCTTCGGAGCC
GATTGAGTCTCGCGACGAAATGGAGTCGCGGCGGTTTGTGCGCGGTGTGAACGAGCAATTCAGTCTCTCGCTCCGGTCGCGCATGTTCTTCAACTTCTCC
TCCCGGTTCTTGTAGAAGTCCGGCTGGTACAGCCTCGAGAACACGGCGCCGCCGTCCGTGCGGATGCTCGAGCGCGACTTCTGGGAGCCGCAAACGGAGC
CCGTGAAGTTCTGAGG