Description :
From Genome Similarity Track
Location :
contig_38:363827- 393752
Transcript NameFunction/comments
g7132.t1hypothetical protein
g7133.t1hypothetical protein PHYSODRAFT_536873
g7134.t1hypothetical protein
g7135.t1hypothetical protein
g7136.t1conserved hypothetical protein
g7137.t1hypothetical protein
g7138.t1conserved hypothetical protein
g7139.t1hypothetical protein PHYSODRAFT_466952

Sequence
29925 bases(100 bases per row)
GTGAGGGCTCAACCCCCCCCCCCCCGAACTCAGATGCTGCAAACCTGAACGCAGGAGGTCCAGAGACGCAAACCAGCCAGCTAACACCAAGAAACAAAAA
ACGAGGCAGCAGACAATTGAGCGCGAATCGCGAGAGATTGTTTCTGACGCTGAAAAATCGCCCACAGTCGCTCTCTCAGCTACTGCACCTCGACCCGATC
AGCTCCGGTGGATCATTCAGCAACAGCAGCATACATGTATATCGTATCTCAACAGCAGTCAAATGTCCAGCAGCAGGCGCAGGTCAATTATCAGAAGCGA
CTCAGTCACTACCGGTAGCGTTTCCTGTTACTACAGTAGACGGCAAGACTTTCGCGCTGCTGCAGCCCGATCTATGAATGCTTTACGTCCCTAGGCAACA
TGCTTGGCTTCATGTACCAACGTAATTCACTGCGCCGGCTCTTGAGTCGCAGCTAGCGCACCTCAGCCTTCCCGAAGACGCACAGGTATCACTGAGCGTA
GCCAGCAACAGGCGGTGGCTAAGTATGCTGACGAAAGAAAACGTGATGAAGCTCTTGGATTGGGAAAACGGAAAGTCCCTGCTAAGGGTGTCGTGTCGAA
GAATAAAAAAACATGCTACTCCGCGCTTTTAGAGCCGATACGCATGACCTAAAGATTCCTTTATAGTTTCTTTTGGGAGTTTACTTGCAGAGGAACATCA
TAGATCCGACCGCAAACTTTGTCCGACAGAAATCAGCTTCAAAGAAAAAAGCGTGACCCACGACTTCGCATGTTGTTCCCTGAAAACGCCAACGTAGACT
GCGAACAGTTAGATGAGCAGCATTTCACTGGAGCTGAAAGTGCTCTAGCGTGCACGAGCACTTGGTGAACCAAGCATTTGGAGCAGCCTACGTTGATCAC
GACACAAACATTAACTATCGGATGGCCCAAGCGGATTCTGGTTAGTTTTATAAATCATCTACATCAGTACAAAACTCCCTGTTTGCTTCATCCAGCATCT
AACACACACGTGCTAAGGTGAAACCAAGTGATTTTGCACAATAATTATCAATCGGTATTACTTCGTACTTCAGTATCCTATAGCGATATGATTTCCAAAA
AGCGGGGTCAATGAGTTTTAACCTTGGTTGGCGACTTTCAAAGCAAAATTGGCTTGAGTGACGAATTGGATCAAATATACATGTAGGAGTGCGTAAGATG
GTATGGTTGTCAATTTCTAAACAAATACAAACCGTAGCGACAAGTTGTTGTAGCTGCAGTAGTTGAAGAAGATATGTTGATGTGCCAGCTTCACGTCAAT
CGGTGGTCAAAATGCATCTCGAAAGTTGACGTCAGGAAAAGCACTGTTCAAAATGGGTTGACTGAAGCCTGCCTTGGTAGCCCAGTTCGTTGATCACTGC
TTCGTAGTACTTACTATTTCAAAAGTGCGTTACAACTCTGTGTGACCAAACAATTTAGGTGAGTCAACACTTGATATTCATCAAACATGCTGCAGTGTTG
ACGAGGCCAAGTTCGAGTCGCAGATCACAAAATGGTCATTGGTGTTGATAGAACACTCCCTTACACACGCCTTGATATATTGTGGAAGGTATCGTGTTGT
GCGAATGCAACCGAGCAATACACTGCAAAGAGCATTCGCTACTGAGTTATTATTGGAGGAGTTGAGCATCTGAACTTTCGTCGTTCTCGAGTCTTGCTTG
CTGGCTGTTGTTTCTTTCAGATCGATCTATGCAGGCCTAGATAGTGGCATGATGCCCAGTCCAAGCATACAGTTAAACAGTATCCGCGATCTGGTCCGCC
TCGCTGGACAAGAACCCAGCTCGTCCTCTTCGCGGATGGAGGGGCAGTCGCGCAAAATAGCGTGCGAAATAGCCAGAGCTCCGCTGCATTTATAGTAAAG
CACAATATTTAGCAAGCTGACCACATCCGCAGTCCTAGAAATCGCTAGCACTTACCTGGCCGAGCAGATCGTGAACAGGATGGATCCTCCAAACACGACA
ATCACAGCGGCGCTCACTGCACATGCAGTCGCAAAGCATACGCGTTAGCACATTTCACGCTAGCTACTGAAGAATAGTGCACTAACGTACCACCGAGCAT
ACCGAGCTTCCGCTGGTCGGGTGTAACCGTGCGCCCCATAATCTTCGTCGGGTTCTCGGGCGACTCATTTGCCGTCGCGCTCGACATGTAAAGCCAAAAG
CCTCCGAGGCAGATGAGCACAAAGAGGAAGAACGGGTTCAGCAGGCTGCACCAAAAGTACAACAGTCAGCAACGCGTCCTCTCATCTCGCTGGCGACGCA
ATGCACGGTCGACGTACATGGTGACGACGCCCACCAGCGCCGCGGAGATGGCGTAGTTGGCGCTGAAGAACAGCGCGTTCTTGCGGCACCGCGAGGCCAG
CACATCGCGGCCAGGCACATTAAACGGCTTCTCTTCGCCTGGTAGGTCGATCAGCCACAGCATACCAGTTAGCATTGATAGAAAGGGACTAGGATGGAGG
AGAGCGGGGAACCGCACCGAGTCCGAAGAACTGGGAGATGCCGCGCACGTTGCGGATATCGACGGCCTTGACGAGCTGGTTTCTGATCTTCTGCAGCGCG
TGCTGCGGCACCTCAATGGTGATGGAGCCCTGGGCTCGTCGGACGCGACCTTCATAGCGCTCATGGCAACGGCGGTGCTTGTCTGGTCGTCGAGGGAAAG
AGAAGTGGCTTGGGCACAGAGAAACTGTTGGCAGGCTCCGGTTGGCCAGAATAGCACACAACTAGCGAATCAAAAATAGGCTGAATTGGACCAATCGTTG
GCCACCTAAGATCTGTCCCTGGAGTGATGGTCACGCTTCAACTTGCATTCCGTACTCGCTCAATCACCAAGATGCAGACGCGCCGCCAGAGCCTCAAGGC
GCCGATGAAGAAGACCTACGAGCTGGACGACTCGCCAGAAGAGGACAGTGAGTGCGGATGCGCCTGCGCTCGCAGCTTCGACCGACCTCGGCTGGCTGAT
GGGCAGCTGCAAGAATAGCCGGCGTATACATGGGTCTTATACTAACGTCACGCCATGTCCAGGCTGCTCTTATGATGACAAGGTGGAGCTTGCAGCTAGG
AATAGCTGAGTAAACACGGTTGACGTGCTTGCTTTTGTGCAGGAGAACGCGGTGAATGCAGCGATCCCAGGACGAAACAGCAAGAGGAAGGGCGATTTGG
AGTCTCGCTCCGGTCGTGGAGGCCTGTTAAAGCGACAGAAGACAGAGAATACTGCGAACCAAGAATCACCACCAATATTCGCCTTCAAGACGGCGAAGAC
CTCGTTTCGCAAAAGGAAGGCGCTCAAGCTCCAGAAGCAGCTAGAAGATGAGGAGAAGAACAAGAAGCGGATCGACGACTTGGTTGCGTACTTCAAGAAC
TTGGACGAGCAAAAGCTGGAAAGAGCTTGAGATTGGTTGCGGTGAGCTCACTCTTTTTTGTAATGCCAAAGTGAGTTGCTGAGCGATAACATCGCTCATG
CCGACTGGGCAGTCGCTAGCGCAAGAAGCTGATCGCAATAGCGAGGACTTTGGTGACGAGTCCGATTCTCTTGCGCCTTCTTCGCCAGCCGGGGAGCGTC
GATCGCTACCGTTTCCTTCAGAACATTGAAGACGGCCTCCTGCGCGATAACCAACCAACTGAAGAATTAGTACACCTCTACAACTAAAAGAATCGTAAGG
CGATTCAAGTTACGTTGTTGTGCGTCCTTGCTTACCTGGATGTCGGGCTCAGAATCGTCTAGGTGACAAAAAGGCAGTCCAACGTGTAATCGATGATTGT
TCCTTGGAAATGCTCTATCGGCGCAGCTTTCAAAAAGGTGGTAAACGTCTGACACGCCGCTTTTCGCACAGTGTCATTGCTGTCATCGAGGCGCTTCAGA
ATCTCGGCGTAGAGTTGATGAACTGGTTCCTCTGTAGACAACAATCACAATAGCTGTTCGTGAGAAATATGCTCCCCCTTCTGAGAAATAGACGTGCTTC
ATACCCCCCAAGCACCCAGGCAATGCTACGAATAGATATTGCAGCGCAAGGCAGACCAGTTGGCGAGTCTTGGCATCGCTGTCGTCCATCGAGGATTTAA
GCACAGGCAGCATCTACGATGATAGCAACAGCGCAGGTATTAGCACAAGCACTAACAATCAGAGAGGGTACTACCAATACACAAGCATTTACCTGAGGTG
CAGTCTCAAACAAGCACGGCTGGTCGGCAATGCCGTGGCGAAGCAGCGTGTATGCACAAGCAACAGCTACTTTTCTGATGGGTGCAAGTAACAAGTCCAA
GCATCGTACTACAGGAAGATAACCTTACTCAAAGCATTTATCACTCACCTAATAGTTGCAGCAACACGCCCTCCACGCCACACGATGTTCGGAATGATAG
TTTTCTGGAGCAAAGCAACACTAAATGGCTTAAAGGCCTGGAAAAGTAGTAAACACAAGTCCATTAGACACGACATGAGCCATGAGCAAAAGCTACGCCG
AGTGATAGCGTACCTGGCTGATAGTATCCGTCCCTAGCATCGTCTCCAATAAAGCAAGGAAAGCGAGCCGGACATCCGCATCTTGAACTGGGTCGAGGTG
CACCAAGAAGACGGGCACAATTTTCTTCAAGTTTACACCGCATGCCTAAACGAAGCAAACCAAAACGACAAGTTAAAATGGGCTTCTAGCAGAGATACTA
GAGCATAGAACGTATTATACCACTCCTCCACGTCGACAAAGCGAGTCGAACAGTACGCAACTCGGGTCGCTTTTTTGCCAACTGTTTGCTGCTTCAGTGG
GAAGCCTCATAGTATCCAGAAGCTTGCCCATGTAGCGTGCATAAAGTACCTAAAGTCAACCGAAGCCATGCAAATTAGAGAGTACTTCACCCAAACGAAT
AAAATGAGACTAACCTCAATAGGCTGCTCAATCTTGACAGCCAGATCCAACATAGCTTCGCTTGCCTAATTCCATTCCAACGACAGCGTTAGCACCTTCG
CGCATTTCAGACCCAGCAATACGTCGTGCAGGTAGTATACCGTCTCATAGGCAACTGATGACTCTGGTGACGCAGCGAGGAGGTGACTCAGCACCCAAAA
CAGTCGGAAGCAGATCTCATCTTTTTGCGAGAGCAGCGGTGCAGCAGTCTTGATAATACTCGCGACAACGCCAGCCAATTGATCTTGCAGGTCTGATACT
TCAGACTCGCGCAGACCAGCGTCACACAATGCCTCGGTGATCAGCTAAGCGGTGATCAGCACAATGATAAGAGCGGTTAGTTATAGTCTACGAAAGTTCT
TACTGATGGCAATCCGTGCGTACCTCCAGGTGAGCTCCAATCGTCTTTGTTGTCATGCCTTCGATACTCATACCCAGCAGGACTAAGCCATTCGTGCGGT
GCTGCGCGGTATCCTGGCCGGCCAGCCTACCTGCCACCATTGGCAGCAAAGAAGCCAAAATCATTTGGGCATCAGCGTAAAACCCGACAACACCTGAGCA
AGCCTTCACACTGTTGAAGACGGGTTCCTCGTCGTCACGGCACGTCTTGCCTAACGCCGAGAAAACCTTGTCGAGGAATGGGTTCACGTTCTGCTCTAGC
AACACCAGGTACGCACTGAGAACTTGTGTGTAGCGTTCACGCACTTGCACAGTCCAATCCCCCGTTTTCTCGAGAAGAAGCGGCAACACCTGCGCTCGAA
TAGTCACTGCGAGTTTCCGAGCTCCAAGTGGTGGGCGAGTCTCAAAGAAAAGAGGTGGTGTGTTCTTCGCTGAGTCCATATCCACCTCCATCGGCTCTAC
ATCGCCGCCTTAACATTTCATCTTCATCCCGAGCCTCCCAGATTACTGAAAGTTCATTCAGTTTAGCGAGAGATAGCTGCCGAACCTCGGGAGCTTCATC
GATGATTCCTGCCAGAAAATGGGGAAGATGGACGCTTCATACTGCTGAATCTGCTGGATCTGGGCTAGCCACGCAGCCAGCATGATCACTAGTTGCTTCC
TCACGGACGGGGCATGGTCAAATACAACCTTCTCAACAGCTGGGAGAAGCACCTCCTTGATGAGCTCCGGTAAAGCCTCCGAGCCACAGGGAACCGCAGC
TTCCAACGCCTGCAATGCGCATACGCGCACGCGGCTGTGCTGGTGGCCAAGATTCACAACCATAGGTCGCACAATAGCGCCAATCTGCAAGGCCACGTCG
CTCTTCCAAGTCGTCGAAATCAAGATGACGCACTCTGCTGCCATCTTCTTGGCGTCCGGGAACGGGTCCACCGCCGTCTTGCCCAATGCGTTGGCCAGCT
CCGAAATAACGTCACGCAGTGACGTCGCCGATACTGTCACTGCTGCAAACTGCTTCAGGAATGCGTGCAGTAGCTGCAGAACGAGCAGGCGGATCTCCTC
CGTCGGCTCCGGGTACGGCAGCTTGCCGAGACGCGCGCTGGACAAAGCCACCAGCTCCTTCAGAGTCGCGTCCGACGGCTCCAGCGCCCCGTTCTCGCAC
AGAACAGTAGCGATGTGAGCGCTCGCTCGCGGCATTTCTCGACGGCATCGCTTTCGGCGCATTGCAGCAGCGGGCGCTGCAGGTTGGCTACGCACAGAGC
GCGCAGCACTCCAGCGGACACCCGCGACGCCTCATTCTGCAGTGCGCGGTACAGTTTGTCCGCGGCACGGCGGCGCACGCTTCGATCCGGGTCTGCCAGG
CAGTTGACGTCACGCTGCATCTTCATGGACAGCATGTTGTACGCGGCCTCATCCTCCGGAGACAGCGCCATGGCTTGCAAGCAGCGGCGTCGGATCCAAA
ATGACCCGCCACTCAAGTCGGCCATACAAAAGCCAAGTGATGTAAGATAGGGCAACTTACGTAAGAACTTTATGTTGCAGCAATGAGGTGGACAGCTTTG
TCGGCCCTGAACCGGCAAAGAGATACCATGTACACTGTTAGTTGCTCTATGTGTTTCTGCTGAAACTCATCTACTGTTTGTTGCCTCTATATGAATACGA
ATTGCTCAGATGCTTCGGACGCTGATTGTAAAATCGCCAGGCTTTGCTGAATCGAAGACATGGCTCACTTCTTCTTGCCCTGCACGCGTTTGCGGCCGTT
GGCGGTGAGCTCGCGCTTTCGCATGCGGATCTTGGTCGGGGACACATCGATCATCTCGTCCTCGCCAATGTAGGTCACAACATCTTCCAGGGACATCACG
CGGATCGGAGACAGCTTGACGTTCTCGTCCGTGCCGGCAGCACGCATGTTGGTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGC
TGTGCTCACCCACGATCATACCCTCATACACCTCGTCACCAGGCTTCACGAACATCTCTCCGCGGTCTTCAAGCGTGTTCAACGCGTAAGCCTGTTTCCA
GCAAGCCATATTGAGTAAATAGGATTGGGGGCACGAACGATCGTACATTTAAGCTATCATCTTACCGTGCACATGCCTCCAGACGAGGAGATAAGCTTGC
CCTTCGACGGAGGAGTAGCCGAGCCTTGGAACGGCGAGTAGCCGTGGAAAATCGAGTTCAGAATTCCACTTCCGCGAGTGTCAGTCTTGATCTACACATA
GGAAACATGATCCAGAGTAAGTCCTTATTCGAGAAAAGTGCTCGGATTCAACGCATTTACGCACCTCACTGCGGTAGCCCATGAGACAGCGACTGGGAAT
CTTGAACTGGAGGCGCACTTTGTCGTGCATCTCCTTGAACTCGATGATCTCACCACCACGGGTCGCCAGCTTGTCAATAACCGTGCCAGAGAAATCGGAG
TCGACATCGATCGTCACTTCTTCGATAGGCTCCAACTTCTGGTTGGTCTCCGGGTCCGTCTGGAAGAGCACCTGGGGGGCAGAGACAGACATCTCAAAGC
CCTCACGACGCATTTCTTCAATCAGAATAGCAAGCTGAAGCTCACCACGGCCGTGCACATCGAAGGCCTCCGACGATTTACTTTGAGAAATGGAGATAGC
AACGTTGTTCTGAAGACATCAATACACAATCATTCATCAGTGAATCACTCAGCTCAACAAAAAAGTAAGAAAAGCAAGATCCCACTGACCTCGCATTCGC
GCTCAAGGCGCTGCTTGATATGAGAAGATGTGAGGAACTTTTTCCATCCTTGCCTGCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGC
GGGTCCAGCTGCGGAGAGGGAATCGGCTCCGTCACGGCCACGTCAGCGATGGTGTCGGACACATAGCGTTGACACCAGCAATGGTGATAATGTCACCTGT
TACAACGAGTTAAGCACAAAACATGAAGTATTAGCATGCAAACGCCTTCAAGCATAAAAGAGTGATGCTCTCAAACATACCAGCGGTAGCCGACGTGATC
TCCGACTTCGAAACACCACGGGTCACGAACATCTTAGTCACTCTGCCAGTCTCAAGCTTCTTGCTCTCGCGGTTCATCACTTGAATCAAGTCGCCAATCT
AGTCAATGGCACAGTGAAAAAGCGCGGCACATTCAAAAGTCAGTACGAAGTGCAAGAGCATCATCTAGAACGAGCCAAGCCCACCTTGACAGTTCCGGCG
TGTACGCGGCCTGTCGCCAGACGGCCGACGTACGGGTCGTGTCCGATCATTGTGACGGCCATCGCAAACGGTTTGTCGGCGGTAGCTTCTGGAGCAGGCA
CGTAGCGAGTGATCTCGTCCAGCAACGGCAGCATGCTGTCACGCGCCTCACCGTTGTCCAGGTCGTGCACGGCCCAGCCCTGTTTCGCTGACGCATACAG
CACAGGAAACTCCAGCTGGTCGTCGTCGGCGTCAAGCGCCACAAACATGTCGAAGAGCTCGTTCTCCACAGATCCATCCAGACGGCTGGTGTCGCGGTCC
ACCTTGTTGACAACGACGAGTGGCTTCAGTCCGCGGTGCAGCGCCTTGGTCAGGACAAACTTGGTCTGCGACATGGGGCCCTCCGTGGCATCCACGACCA
GCACCACGCCGTCCACCATACTCAGGATGCGCTCCACTTCGCCGCCAAAGTCGGCGTGACCGGGCGTGTCCACGATGTTGAGCACGTGGCCGTTGTACTC
GACGCGCGTGCACTTGGACATGATGGTGATGCCGCGCTCGCGCTCCAGGTCAATGGAGTCCATGACACGCTCCTCGGAGAGTGTGTTGCCGCCGTGCTTG
AGCAACTGGTCCACCAGCGTGGTCTTGCCGTGGTCAACGTGCGCCACGATGGCCACGTTGCGGATGTTCTCAGCCGTGACGGCCGAATAGTCGGTGGAGA
AGGCGCACGCCAGCGTGGGCGCGCTGCGCTGCAGTATCGAGCGCTGGCCCGAGCGCGCGCGCGCCAGGGCAGGCAGGCAGGACCGACGGAGCCACATGTC
GAGCAGGTGCAAGCGATTGATACACGAGGTCGGGTGATGTGCGTGTGTGGTGCAGAGGCGTCAGCGACCAGGTGATGTGGACCACGTCACAGTAGTGTGC
TACACGCCATTTCGGTGGTGCAGACCTGGTACTCTGTACCATCGAATGGATTTGTTTCGCATCAGGCTGCTTGAAACTGAAGCTGCCTCACTTCGTCAAA
CGGACGAAGCGCGTTTGTCAGCGTGACTCGAAGGGCCTACTAGTACACACTGCATCTGAGCAGGTGATATTACCGTATGCATGCTTGACAAGTCCGTCTT
TAATAACCTGAAGAAAATCGTCAATTGACGCGACGGTGACGAAATTCGCGGTGACTCGTTCTGTGAGCAACTCTGTAGCAAGAAGCGACGCGAACCACCG
ACCATTTATACCGGTCCTTCGCAGTCCTCTCGTTCCTTTCACGCGGTCGCTGAGTACAGGTGTCTGCCCTTTGTATCTTGCACCAAGGCTCACAACATCG
CGAGGCACCTTTACTAGACTCATCCGATTTACCGCAGCCTACAATCAGAAAGCTGCAGCCTGCAGTGCAGGCACTGTCACTTGCGACGACTCTGCTTACT
TGCCGCCCCCCCGGCCGAGGCAGGACATTGGACGCGCTTACAATCGAGGGAGCTGCGTCGTTCCTTACACTCGAGGGTTCGATTTGGATTAGTGTACACC
ACACCAGGCGTGTCAAATGGCTACCGGTACATGTAATCAGGCGTGTCACGCTGAGCCGAGCCGAGTACGCGGCCGATTCTTGGCCCGCGTTGCACCATGT
TGGGGCAAGTGCGTGGCGGCGAGTCGCCGCTGTCGAGTTCCGCCTCGATTGAGGAGACTGCAGTCATGGCGAGCTCGTTCTCGCTTCGCCATCGGTCTGT
GGTGCTTGGAAAACATGAGCAGGATGCGGCGCCGCGTCTTTGGAGGCCAGTGGCTTCGCATCCTGCGATTTGAAGGACTAACTGCAACCTGCGGCCCGAT
CTCTGCTCAGAGTCTGAGCCGCAAACAGCGGATCAAACACGCTCCCCGATCGTTGAGGCTGTCCATAGAGAACCACACAGACGCAGGGCTGCTGCTGCTG
CCGCGCCCGCGGGCAGTTTGTGAATCAAGCGCGGCCAATCGCGGCGGCGCGGGTATGGATAAATCAGGATTGCCCTCCTCTTCCGCGCTTGACATTGGTC
TCTGCTGCAATGGCAGCCAGCAAAAGCCACTTTGCCGCGACATTCGCGCTGCCAATGCCTTCGCTCGGACCGGTGAAAATTCAGAACTGTTTGCGTGCGA
AGGTCGGGCCGAGGGACCAAACGAAGGGAAGGCGGGGCGGATACATGTGTCCACCCGCCTCGCGGGAGTGCACTACAGGTCGTTTGCTTGGTGCTTGGTA
AATAAGCAGTCCTTGACCAGTGGTCAAGTCCACCGTCAGCTGCAGATACCACCGTCCCCCCCCCCCCCACCTTCTAAATTGTCTAGCGGGCCGGCTTTGC
CTTGTTGTTTGTATTCAGCGAGGCGCAAACCCGCAGTCCCGGCCCGGGTTTGTGCGCAGCCTCTATGCGATCCCAGACGTTTGATGCGGAAGATCTGTCC
GAGCCTTCATTCCGCATTTTGCAGGCCGGCGTTGCCTTTCCTCCTCCTCGAGAGTCCCGAAGAAAGCCTTGTGCGCAATGGGCCGGAGGACCTGCGCGCT
GCTGCTGCTGGCGCTCACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACCCGCCACAACCTCACGGCTCTCCAGAAGCGGTGGATC
GACCCGGACACGGACCCCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAACGCCAGCGAGATGAACGAGTACA
CGCTCATCTTCTCGGACGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTCGACATCCGAGATACGACCAACAT
GGGGCAGCACTACTTCCTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGAAGCGCTACCGCGGCACCAAGTAC
GTCAGCGGCAGCGTGCAGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGGCAAGTGGGGCATCCCCGGCACGT
GGCCGGCTATCTGGATCATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGCTTCGATGTCTGCGCCCCCTTTGT
GGAGAAGACCGAGAAGGTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACCCGGAGATGTACGGCTTGAACCCG
TTCCAGGGTCGTGGTGCCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTCGACGTCGCTGCAGATCCGTCCTA
GTCTGTCTGAGGACATGCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGCGAATTCACGCGTATTAACAGCGA
CTACTATGGTGAGGTTGGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACTTGTACCGCCTGGATTGGTCCCCT
GGTCCAGAGGGTTACATCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTGGGTGGGTGATGTCCCTCCTCGCC
AGCTTCCTGTGGAGCCCAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAGTTCTCCCCGCCGTGCGATGGTCAGATTTGTGACTCGATATGGCCCTCG
AACTTCACGATTGACTATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGCGTATCCTACGAATGAATGGATCT
ACTCGCATCCGGTAGACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCAGTGATTAATGCTCTTGTGGGCTT
TTCATGGCTTTCCGAGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTTTTATGGAGCGATAAGTGCAAGCG
CCCCAGAAGAATTTGCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTCGTGTACCCGATTTCGCTAGGTGC
GATGCTTGGTTTGTATGGTGGCGTAATGATAAGCCAGTTCGTGCCTTTGCTTTCTACGCGGGTGATCACTGCTGTGTTTGTGGGTGTGGGCATCGCGCTG
GGGTGTGCGCCGCAGATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCTATCGATTTCGCTTTGGGTGAGCG
AGGGTGACATTGCCGACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTTTGCTCGGAGCACTGCTTAGCGAT
GTATGCGCTTCTTCTCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCCATAACGCGATTAGTGCGCGCAAA
GCTAAATTCCCGCAGGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAAGAACATGACCAACTTCTTTTCAC
CGAACAAGCTGCCGCACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGATTCCAACTTGACAACTTCCGCAA
CCAGACAGAGCACATCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATTTGGTGTTTTCTAACTATAACAAG
TGGTGCTCGAAGTTGAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGACGAGATCTCGGTGGACTTGTGCC
TGTTTTTCTTCATCTGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGATGAAGGAGGAGTTTCCGTCGGTTCG
TCACTCCGAACGCGAGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGATGTCGAAGCACGACCACGAGGAC
CGCCACAATTACGATGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGTTCTCGACATGACGTCGCCGAGCC
CTGCCATGATTTACCAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGTGGTTCCAAGAGCGGCAATTTCTT
CCAGAAACGCAAGAGTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTACCGCTGCGCGCCTTCAACCGTATC
TTCAATTTCCACGTGATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGACTTGTGCAAAATCACGTCAAGCA
CTCTGATCACACCCTTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGAGCGTTTTCGACGGTGCGTAATGT
TTTGCGGGTGCTTTTGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTCTGTGGTGGCAGACGTACTACGTC
GTCACGGTGATTTTCCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCGACGTACTACGTTTGTTCCCATTG
CCTTTATCCGTGATATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGCGTGGGCTACCAGTTTTTCTGGGC
TTCGCAGCTTTTATGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGTATGCCGACCATGTGGAGAATAAC
GTGAGTATGATTACAACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCACGATTTGGAACTCGATCTGGATGG
CTTTCACGGGTACCTTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTTAGCCGTGCTGTGGATGCGTTCAA
TGCAAAGGTGATCGCTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCGCTGTTGGCCACGAGGTGCTAGAT
CGCGTTGCAGGTGGCGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCTCTGCTCTCTTTCTCGCGTCGCAA
GCAGACACCAATGGAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCGACAGCATGCGCGCGGACGATTTG
ATCTCGAACAGGGAGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTTCCAACTGGCTGGTTGCTTCGAAA
ACTTCACTTCCAGCATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTTCTGGAGATTCTCAGTGAAAGTCC
GATGGTGGAGGAATCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCGTGCCACAGCAACGATGTGAAGTACATCACA
AGTGTTCTCAACTCATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGCTTTGGCTAGCTTGGTGTTGTTAT
TGAAGTCCAACGCCCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCGTACGAATTCCCGCAGCAGTCGAG
CTCGTACCGCCCTGCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTCCTCGTCGCAGTCGTGGTTCTGGA
GTTGCTCGTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCCGAGCGCTCACATCATGCAGATCC
GCGAGCGTGTGCGCACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACGGAGAGCAAGGGTATTTCGGACCG
ATTGACATGGATTCTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGTCGTTTGAAAGCCACACGGACGTG
GTGCTGTCACACCTGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCGTCTGCTGTTCTTCGTGAACTCGA
TGTTTATGGATATGCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAGGACGTGCTGTACTCAAGAAAGGA
TCTTGAAAGTAAGCAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGAACTTCCTGGAACGAGTGAAGCCG
AAGAAGAACATCTGGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTCGCGTACGGTTCAGGGTATGATGT
ACGGTGAAGCAGCCATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACGAAGTTTACGTACGTCGTGGCTTG
CCAGATTTATGGCCGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGAACCTCCGTGTTGCTTACATCGAT
GAGGTGCGCGTGAACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGTGCATGAGATCTACCGTGTGCGGC
TGCCAGGCAACCCCATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAACTTGCAGACAATTGATATGAACCA
AGACGGATACCTCGAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGTTCACAATCGTGGGCATCCCAGAA
CACATTTTCACGGGTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCAGCGTACACTGGCGCGGCCACTGC
GCATGCGTCTGCATTACGGTCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCCAGCAAGGGCATCAACCTCAGTGA
AGATATCTTTGCGGGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGGGGCGTGATGTCGGTATGCAGCAG
ATCTACAAATTTGAGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCAGCGACTGGACTTCTTCAAGCTGC
TGTCGTTCTACTACAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTATTGCAACCTGCTACGCGCTTTGCT
TTCACTTGAGGGTGTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCTTCACGACTGCACCGCTGCTGGCA
ACGATTTCTGTCGAGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTACTTCCTGTTCCACATCGGCACGA
AGTGGTTCTACTTCGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAGCACTCGTCTTTCGACGAGCTCTA
CCGTTTCTGCCAGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTTGGCTTCCAGTACTTATCGACGAC
GTGGTCGCTGTGGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTGACGTGATGGAAGATTTCCGTTTG
TGGTTCAAGTGGATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTACTTCTCAACGCTCCGTCCGTGGT
CCAAGGCGTGCATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATATCACTCGATCCTGACTGAGTCGAC
GTGGCTTCCGTTGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGCGTTCCAACGGTGAGAATGGACTT
GTTCGATTCCTGAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTATGTGGCAGTGTCTGCTGAGCATGG
GATACCTCGCTGCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTACTTTGTGCACGATGCTGTGCTCGG
TTTGGTGTCGTTGAGTCTCATCCTGCTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACAACAATGCGCTAAGCCGCGGCGTG
GTCATCGAGGACATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTCGATCATCATGGAGCAGCAACGAT
TCATCAACGTACTGACTGCCAGCGGCAGTGATGCCGACACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCACGCTATGAGCGACAACACGCTTA
ACGCGGTGTTGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATGTCGGAGGAAGAACGCAAGGTGGC
GCATCGCAAGAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAGCCTTCTCCACGAGCGATTTTTCG
GCCATTCTGCCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGGCCACACTGCCGTGTAGATAGTTA
GACGAACTAGTAGGTAGAGCCATTGACGATGGCTTGCTTTGCATTTTGAATGAAAGCTACTGTACCTGTTGATGTTCACACTATTCTTTTGTGTTGCGCG
CATGCATTGCATCCTGGTTACGGTGATGTTATGGAGACTTCGCAACCAAGTGATTTTCGGGGATAAAAGAAACTTCAGTGCAGGGCCCATTCAAGCAGCA
GGAACGTGCCAGGTCATGGCAATAGCAAGTGCATGGAAAAGAAGTGAGACCAGAAGAATCCAAGTCTTCAGCCTGGCCATTTGTCATAGCATTATGATGA
CTACCGATTCTGCAAAACCAATTCCAGCTCTCTCCAATTGGAGAATTCAATATCAGCACAACCCCTGAAGAACAAGTGAACGGAGGATGGATATTACTGA
AAGAAGAAAAAAAGGCGTTATGGAGTGACAGCGACGAGCATCAGTTTTCCAACCCAAGGCACCAGACACGCCAACGCGGTGAAAATGTTGGACAATGGTC
TCCGAGTCTTCAAACAAATAGGCGACGCAACAAGGACATATCTCCGAATCGACAGTGTGGATAAAACAATTCAGAAGACCCTCAGTGCAAATCCAGACAC
AACTTCAAACACGGGCCACGCCCAGGAACTGGGCTAAGAGCTACAGCGTTTTTTCGATGTACAACGGAGCACACCAGCAAACACGACCTGGAAGCAATTC
GGACACTGGCGAAAACACAATTCTGTCTCCCACAACAAAGAAGAACACCGGATCCGCTGCAGGACTACCTCACCAACTTCACGCAACAAGATTCAGCGCC
GCTACGTCAGACGAATGACGTCTTTTATATTATCAAAAGACTTCTATTGAAAAAAAAACACGTAACAGCAAATAGAAGACCACTTATCATCGCATTGCAT
TCCTGGTTGTGTACAGATAGCACAAATGCTTGATTGTTACTACTGTAGTGGTGGATACGCTACGAAACACATACGTCGTACATGTACTTCGCTGAAGTAC
AGTAGGTAAATACACACATAGATTCCATCAGTAGCGTCAGGGCTCTAAGTGCCAGTAGGTAGCAACAGTTTGGCGTCGAGAGCTCAACGATCTATCCATG
GATAGCGCGAATCACTGGTCGGACTGTTTCCTGGGCTTTTTTCCGAAGCCGAGGAACTTCATGTTGGCGCTCAACTTTTTCGACAACGAGTTTTTCTGCA
GTGGATCAGCGCTGGTCAGCACAGCTGCCTTGAAGTTCTCGGTCACCTCGAGATCGCAGTCGCAAGCCTCTAGCTTCTTTTCGATCTCGTCTAGGTTCTT
CTCCGAGACTGAGCGGATCACTGCCAAATCATCGACAAGCTGCGATGAAGACACGTGGGAGTAGATCTTGCGGCTGTCGGACGCGAAGCACTCGTCGATA
TCTTGGCTCGGAGACATGGCCAAATTGGCGAAGAGTTGCTGAATTGCTGGCGAATTCTTCTCAATAAATGGATTGAGCACCCTAGACATAAGTCAATACA
ACATACATGTGTTAGAATGCGGCACCAGTAGCAACATTCATCATGTGACGCCGAGCGTACTTGAATTGGGGCTCCCGATCTCCAAACTTTACACCGGTCG
CTGTCTTGAACAGCAAACTAGCACGAGCACGCGCCGAGTCTCCGGTGGAGGAAGCTGCTTTGTGAGCCCGTACAAATGCGGGGTAGTGATGGCTGGGCAC
ACAAATCGAAGGAAGAGGAATCCTCCGATCACCGACCGAGTCAGCGTAGACGCGTCTTCAGCCTCAACGCCCTCCTTTGACCCATCAAATCGACTGATGA
CCTTCGAATTCAGATCGGAGCAAATGTGGAAATACGATGACGGGATCTGCGAGTAAAAACAATAAATTTGGACATTAGAAACTCTCTTGTACATGCCAAC
GTCGGAATAAGGTACTTACGCAGTGGGTATTCTTCATGATCGAGTCGATAATGTTCTGGCACGTCTTCATCAGGTTTGCAGCGTTGGAATATGCCTGAGC
TTCGTCCTGGAGTGATTCCTCCTTGTGCGGGTTCAACTCCATCTCGGCAATTTTCAACTTAAATATCTGGTGAATGGGATCTGAGAGTGCCACACGGATA
AATTTCGACCCGATCGCTTTGCTGTACGTGGAAACGAGTCTGCTCGCATAATCATCTGAGCGGAAAAGTGTAGCCACGTTGATGACTGAAGCCACCTCGA
TTTCGATTGCCCAGCGAATAAGGTGGCTAAGGCGGTTGCGACTGCCAAACACGCGGAGAAACGGAGCTAGTAACAGCATCTTGTCTTCTCGTCCCGCACT
CTGGAGAATAGATGCCACCACAGACATAGTGTCTTCGATTACCAGTGAGGGAAGATCTTTCGGGGTCTGTGGCATTGGTGCCCGTACTGACACCTCAAAT
TCCCCGTTCAGAAAATCGCGGGCAGATCTTGCATGGGAAAAAAAATTGCGTATCCTTGGGCTTGCACTGGTACTTGAGCCTGTTGCAGGCGAGCCCGTTC
GTAAAGCACGCTGGTGATGAGCCTCTTCTAGATCGTCCGTTTCCTTTGATGGATCGGTATCAATTCTTTGCCGAATCTCGGCAATAATCTCATCGCTGAT
CACGAGCTGGTCAGGCTGACGTGATTTCTCAGGCTGGGATGACACGATGAAGTCTTTCATGACCTGATGAATCGAGTCAAGAAAGCCGCTCGCCTCCAAA
AACTGACTGTCAGACTGCAGATTACAATACACATACAGTCAGATTCGAAAGCATGCAACGTAAACAGACTACCGAAAGACGAACCGCATCAAACTCTGAC
AGGCGTTCAATCTCGCCCTCCTCGTCGTCATCATAGTAAAGATCGTCTTGTGTGATGGAGAAGATGCTATCATTACTGTCGTTCGAGTTGATTTGATTTA
GACCAAAATCGGTGACATCTGCAGATGTAAAAAGAAAAAGGAGTTAGAAATCACTGGAGAATATTAAGAGCTTCTAGGCGCACCTGAAAAGGAAGTCTGG
GATTCGAGGAGCGATGAGGAGCTTGAGGTGCTTTTCAACGGAGTCTGAAACATAGTAACAAAGCGTGAGTTGGATGTGGACGAACTGTAAATGATAAGAT
GTGACCACCTTACCTTCAATGACTTAGGGTCTACCCGGAAGGAAGACTGCAGATTGCGCGCAATTTCGGCGAGCTCCATCGCCTGTTGCTGTAAAAAGTC
ATTTCCAGCGCCGCAACTCGAGTCGAAAATGCCTGCACCAGTGTGTGAGCCCTTAAAACTGGAGGTGAGGGAGCCATCTTCACTGCTTTCACGTGTCGAT
GACGAGTCTGTGAGGTCATCTTTATTCAGGTTGCGCGCCATTTCTGCCAATTCAGCTGCTTGCTGTTGGATGGATTCGTTCTCTGCAGCGTCATTGAAGT
TAGCTGAAGTCGCACTCAACGGATATGTTAGCGACTCTGCAGAAACAGGGCTCGTCTTTTGAGTCGCAGGCGCTGCCACAGCCTCTTGCTTAGGAGTATG
GATACTGGCATACATTCCTGGTGAGGAGATGCTGGCTGCTCGTGTCCTGCTTCGGTTTGATCCACTCCATTGTACTGCTCGTCTTCATGGGGCGAAGGGA
CCCCCGCGGACTCAACCACCAGGCTCACATTTTGGATATGTTCCCTCCCGTCTTCTCGGCTTATATCACCCTGCGCAGCATCGATACCTTCTACCCCGTC
CTCGTGTTCATCTCCAGGTACTTCGTCATCTTCTGAAAGCACATCAGAAACGGCCGAGCCGCGAGACAACTTGGATATTTCCATCGCAGCGTCGTCCAGC
ATGGCATCCAAATCCAACTCTTCTCCATCAGCATCGCCTTCCTTTCCATGACACTCCTTGTCCCCGTCATTTTCTGCTCGTGCCTCCAACTCGTCACTTC
CTTTACGTCCCTGGCGTTCATTCCGTCCTCGATTTTTCACTTCCTTATCTGTCGCTTCAAACACCTCCAGACATTTCTGAAGCTCCTCAATCTCGTGCCT
CTGCTTTCCACCATCCGCAGAGCATCGCGCAGCATCTCCGACGTCTCCGAGTCGTCTTCACTGGCTCGTTTCCGCCGTCGCGAGAGATGATGTCTTGGCG
ACTGCAAGATCACCATCGACGAAGCAGACGTCGACGACGCCGAGCTGGAGGACCTTGACAGTCTCCTGGCTAGAGCGAGCGCCGCCTTGCCGTCCATACT
GTTCTTCCTTGTGGCCTCCACATTGCCCGCAGCTTGTCGCAGCTGCTCGATCCATTCCATCCGCGCCTCGTGGGACGGCGCGCGGAAGAGCAGCACGCGA
CCACTGCAGGACGTGACTTTCCAGCACGGGCCGCAGTCGTCCCCGCAGTTGGCCGCGTCTCCGTGGCGGAAGATGCGGTCCACGGCCTTGATATCGGCGT
CCACGAGCGGCACAACGGCGCGCGGCCAGTCGCCCAGGTGGGCGTAGTAGTAGAGCGCGTGCGCGTGGATGCCTACGAAGAAGGGCTCCCACGGCGACTC
GAAGCGCCGGCCTTTCTTGTGCAAAATGCGCAGCGTCGTGCGCTGCTCCAGCTCCAGCCCCGTGAGCAGCAGCTCCGGGCACTTGACGAGCTCCGGTCGC
GGCGAGGAGCTCGGGGTCTCTTCCTCCTCGATGGGGATCTGCACCGTGAGCCGCGAGACGCGGCTGCCGCTCGGGTCGAACACCGACGAGCGCATGATGA
GGGAGTGCGTGCGTCGAGCGCCAAGTGATGGCGTCTTCGATGCCTCACGCCGGAGAGGAATGGCAGAGTGAGGAAGGGCAACGGCATGTCCGGTGAATAG
GGCGGCGAACCGGTGCAGTGGGCAGACGGGGCGAGGGGTAATGCACCCCGAATTAGGAGTCCGACACCCGCATTTAGATATGAACGCCCGGCTCTGCGCT
GGAGTCGTCGGTTCGTATCAGACACAGCAGGGCAACATGGCGAAAGAGAGACGACGACGAGCTGCCTGCCCGCGGCATTTGCTTGCCTGGAAATCGTCGG
CAGAGCTGCTGCTCCACGCGGGATAGAATTGCGGAGGTTTGCTTGTCGAGCGGTTCCCTAGATGCGAGCAGATCACCGCGTAGGTTGAAATATCGCGCTC
GTAGTCGCTGGCTTGTCCTCGCGGCGTCGGCGTTCCAATGCGGGCGGCCATAGAAGCCCCGGCGTCTTCGCCGACGCTTTACTGCGAAGCCCACAACTCG
GTCGTGGGCCACAATCACGAGCAGCGTCGCCGCCGTCGCTGACTCTCCGGCTTTTTTATTTGAGCTCGTTCAGCCCGATCTTTTGGGCGTGCGTCACGCG
CGGGGGAAACAAGTACCAGTACTTATCTATACAAGTCTTCGCGGTGCGAGTCGCATCTCGTGCCTCACGCATTTCAGCGAGGCGGCCTTTCACATCCCAA
GCATTTCGCGAGCCTTTCCAACGCAGCCTCGAAAAAAACTTGGACGAAAGCCAGCCAGCCAGGGCAACGGAGCTCCTTGCCTGTCAGGTTCAGTAGAGGA
GGATGCCGCGTTTTGATATTCGCCAAGCGAGTCTCGGTGGAGTCCTCAACAAACTCGGCTGGGCGGTGATTACCAGCAAAAAGCACCCGTCGAACGACTC
AATGCATCAATCAACGGCAGCGGCCTCGATCTCTACTGAGCTACTCTCTCCACAGAGAGCGTGACGCCATTCCATCCAGCACAAACAGCCTCATGGGTAG
CAGCTGCAGCCAGCGAAATGCAAGGCATCAAGGCCTCCAGCTATTCATCGAGCCAAGTGCTCGACTGCTCGTCTACAAGACGTAGCACGAGAAGTTGCTG
CGAAATTGATTCAGCCAATGGGGTGCGTGCATTCGAATTTTGACCAATCGCCAAAACTGCGTAAATTTCTGTGCGCACTTTGTCTCGTACTGCGAGCGCG
GTCCGGTTCGGCGATGCGGTTCGAGAATCGGGCATACAATCAGCAAGTGCTTTGCGGGACCGGTCCCAAGATGAAGCGGAAATGCTGTGCGATTTATTTT
CTGTGGCCTCCGAGCGCTTGGCTACCAGAGCTCGTCCATTCGGCCCTTTGCCCAGATCAGCAGCATCTTACTCCCGTCTCGCCCGGCAGCCATGGTACGT
TTCTCACGAGCCTCTTCTCGAGATGGCTGCAGCCCTGCGCGACACGACGCGACGCGGGGGAACCGGGCGACTAAAAGGGGAGACGGCGGACAGCCCGCCA
GCTGCAGCGTCCAGGTGGAAATCAGTGCGATCTTTAGCCCGTGTGGACGCTCGCAATGACGGCGCCTTCCCACTGTCCCCTGTCTTCACGGAGATCCTCC
TAGTCGCTCCTCCCCGCTGTCCTGCGTGTTCTGTGGCTGCGTTGATTCACATGATACAGACAGACGATTGACTGGATGGTTGGCGCTGTGTGCACAGGCC
AGCAAGTACCAGAACATCTTCGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGGCCACGCCTCCCCCGTCGGCCCCCGTCGCTC
TGAACAAGCCCGCCGCTGGAAACAAGAAGACTGCCAACAAGTCGGCCCCCGTCGGCGACAAGAAGGAGTCGCGTGGACCGCGTGAGGGTGGCCGTGCCCC
GCGTGAGCGCGGCGAGCGTGGTGGCCGTGGCAACCGTGGACCTCGTCGCGAGTTTGAGCGTCGCAGCGGCACAGGCCGTGGAAAGGAGACCAGCAAGCAG
GGCGGTGGTGCCCGCAACTGGGGCAACAAGGCTGATCCCGCCGAGCAGTTGGCTGAGGCCGCTGCCCAGGACAGCGCCAAGCCCGCCTCGGATGAGGAGG
CCACTGAGGAGGTCGCCGCCGTGGAAGAGGAAGAGGAGGAGGTGCAGCTCACCCTCGACGAGTACCTTGCGAAGCAGAAGGAGTCGCGCTCGGGCGACCT
CTTCGCTGACGTGGAGGTGCGCCAGGTGGCCAACGAGTTCTCGAGCGCCGTGCAGATCACCAAGGACGGCAAGACCCCGGACTTCATGGACTCGCAGTAC
GAGAAGGTCTACAGCAAGAAGACCTCTGGCCGCAAGAAACAGCTCATCACCGACGTGGGCTTCCGCACGGAGAAGCCGGAGCGCTTTACGCGCGAATTCG
ACTCGTCGCGTGGCGGCCGTGGTCGTGGCGGCCGTGGTGGTGCTCGTGGCAACGGCCGCACCGGTGGCCGTGGCGGCCGTGGCTCCAACGTCCCGAACGT
GACGGACATGAGCGCCTTCCCCAGCCTCGGCTAGGGATCGCATCGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCAGCGACATGATGAGTGAGATCTT
CCACAAGAGGGCTTCTCGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCGACGAAAGATCCACCGGATAGGGCCTCTGCGCGGCTGGTGTCTG
CCTGACTGTGTGTACCCTCCTGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCCTTGGTATGTCTATT
ATTCAATGCAGCAGGCTGGGCTTTATGCGAACGAAAATACCGTTTTATCATCCGTGGCCTTTGTTTTACTTTGTTGTTGTTGTTGCGCGTATCTTCACGA
ACACGTTGCCGCTTATCTGCAGGACGTTACAGTGACTGATGTTCAGCAATACGACGTGCCTTGACGCTGTCTGGTAGTACTACGATGGCGCCGTGAGCCG
CCCAATAAAAAGGTGTTTGCCGTTGGTTGTCAGTTTCCCACGCTTGAACACCCCAGCCTCACACGGGGGTCGTGTTCCACGATGAGCTCGCTTCCTTCGT
CATCTTCATCATGTTCCCGAGAGAAAATGCCGCGGCCGGAGGGAAACCCATGAATCCACGTACCAATGAACTTCCGTCCGTCAGGGGAAGACCACAATCC
ATAGCCGTGGACCTCGCCCATGCACCATTCGCCGTCGTAGACTTCCCCCGAGGCAAACGTCAGCGCGCCAAACCCATTTCGCTCGCCAGCTTTATACTCG
CCAGCGTACACGCTCCCGCACTGGAAATGGTGCACGCCCTGACCGCTCAGCTCCCCGTCATTCCACATGCCGTGCAGGGAGCCTCCTGAAAAAATGTACA
CACCTTTGCCATGCATTAACCCTTGGTGCCACGTGCCTTCGTGCGAGTCTCCACCCACCCACTCATACTTGCCAAACCCTTCGCGCTCACCCTTCACAAA
GTACCCCTCGTACTTGTCCCCGAGCTGAACACCTTGGTTCCCCACCCGCTCACCTGGTTGTGTCTCCAAGTGCCGTCAACCATTTCACCTGAGGACAGGA
GCTTTTTGCCTTTGCCATGCATATCCCCCTTCTTCCACTCGCCTAAACGAGCAGCACAGCGCACACACGGCTCAAAGGGTGGACACACGGACATGGTGTA
GATTTTCCTTCTCACCACGATAGCTGTCTCCATTCTTCCAGAAGAAGGTGCCGTTTCCATGCATCTACCATAAGTCTCCCATCAGCACCCGAATAAAAGT
GAGCAAGTACTAAAACCTTTTAAGTACCTTGCCTACTCGCCAATTGCCGACGTACTTGTCCCCATTAGCCCACAGGTACGTCCCAGTTCCGTGGCGGTGG
TTCTTCCGATACATGCCTTCATGGCAGTCTCCAGTACCTGCAAAGGTTTGCATGCCGAACCTGCACCAAAGGCCAACAAAACATTATTAGCAGACCAACG
CGTTGTCCACCCGTCAGTGACGCTCGCACCCTTCGAAGTCTCCGTGCACCCAGCCACCTTCAAAAATGTGCCCGGATCCCAATATGTGGACACCAGTGCC
GTGTCGCCTCTCCTCGTCATCTACGCTGCCTTCGTAGCGACTGCCGTCCGCGTACTGGACCACGACGGCCCCTCGCGGCTTCTTCCGGCGGATCGAGAGA
ATCTCCGCGTTGCGATCGCCCGAGGAGGCAGCAGACGCGTCGTCCGCCTCGAACTGCGGCGTTGGTTCCTGCTTCTGCACGCGCCCGGCGGCTGTCGGGT
CGGCTCGGTACGCACCGAAGCGGGACCCGCGGCGTCGACCCCGGTTCCCCATCGGCAGTCGCGGATCAAAAGCAGCAGTGCGCAATGTTCGATCCGTCGC
TGTACTACACTGTGAGTGATGGTCTCTGACCAATTTGATCCAAATACAGGACTAAATACGGATACTGAAATCAAGTCGCGACCGACGGACTTGATCCGCC
ACCTTATCAATATGTTTGTGGCACTCCGCGCGTTCCTGGCGCTCGTGTGGTGGCACCTGTGCCACTTCCTAGCCTACAACCTGCACGTACGCGGCCTCAA
ACCGTCCAGCCAGTTCTTCCACAAGGTCGTGATCATTGGCGACGACTTTGCAGCAGGCATCGGAGACTACGTCACGATTGGCGGCGCTGGCGGCGGCATT
GCCGAATACCTAAAGAAGGTCGTCTCGCATGACGACAAGGCAAGTGAAGCGCTAACGTCGAGATAAACTGCTGTAATTGCAGCGCCACGATGGCCCTTGT
TAGGTCGCTTTGCAGCGTGCTCGCAAGCTTACTCACAAGATACTTTCTGTGCTAACCGCAGGTTCGTCACAACTGGGTCATCGTCAACGCCGGGGTACCT
GGAACCACAACGGCCGACTGGCTCATGTCATCGCCGAAGAAGGTGCATCGATAGTAGCTATCGGAGACTTGTGGCCTGACTGACAAAACGAAATGCTGCA
CACGAGTTAGTACTTCAAGAACGTCTTTACCTCGAGAGCCATGGCGGACGCGTCAATCGTGATCATCGTTCTCGGATCTGTGGAGATCAAGTGAGAAGCG
TGGAGGCGCTATTGCATTGCGCAGCGAAGCGCCATTTTTCTAACATTATTGTGGTTGCTGCTGGCACCTGGATAGAAACCCAGCTGCCGCTGGACACGAG
ATGAAGCGCCACCTCATGGAGATCTGTGATACTTTGCGTAAGAAGGGCAAGCAGGTGTGCCTGGCCACTGTTGCGAGCCCCGACCCAACTGCTGATGAAA
CGGACACCGCCAGCTCGACCCTCAACACGGCACTGGAGCAATTTTGCAAGAGGTACGGCGAGGTTCGAATCCATCGACTTACTCTCGCGAGCAGGGATGA
GCAAGTGTGGTTGCTAGGAAGTGGTCAACTAACTCTCACGCATATGTGATGGATTGGACAGCACATCAACGGAAGAGACGCCCGTTATCCTGGGCCCACG
CCTTGACACGTATGCATTCCGTCGCGAAAGCGCGCTTTCGTTCGACAAGTACCACTTCAACTCTCAGGTACGATAGCTTGCAGCAAGCCTTCAACCTGCA
GTCATTCCATTCCAAGCTGCCGTTCTAAAGCGAGATCTCACTCACCACCCGCCTCTCTGCACCTCGTAGTCGTACCGACAGCTAGCTCGCAACACGGCGG
ATTTCTTGGTCCCATGATGACGGCACAGGAATGGACTACTTGGAAGGAGCAGCTCAGCCATGTCACCTACGACAAGGCCTTGTACGATTAGAACTTTCGT
CATGCACGCCGTTCGGCTGCCGACTCGTTTATCGGCTTTGCAAAATATGCCATACGCCAGCAGACAGCTTCGGAGGTATCCGCGCTTGCATCCTCCTAGC
TGGAGCCAACTGGCTGACTGGCTGACTGCTTGCGCTCGCGTCCGTCCACCATCCAGAAAAGATAAACATTAACACCACAGGAAACACGCGGGCTTTCTTT
TTCTTTCGTTTTGGGTATTGCCTGGTCTCGCCGCCTTCGCTCTCGCGACGTTTATGTGAGCTTCTTGTTCGCTTCACACGCGGCCTTCTCAATGTGTGCA
TCTCCATCGCTTCCATGCCATTGATCTACATGTCCACGTCTGTCGTCAATGACTACAACTCGTCATCTCCTTCTCAAGACTCCATAGCAGCGTCCGGGGC
CGGCTCGCCCTCCGTCTTGGTGGTG