Description :
From Genome Similarity Track
Location :
scaffold_38:363786- 393765
Transcript NameFunction/comments
g12757.t1 hypothetical protein PHYSODRAFT_477034
g12758.t1 hypothetical protein PHYSODRAFT_536873
g12759.t1 putative glycosyl transferase family 48 protein
g12760.t1hypothetical protein
g12761.t1 conserved hypothetical protein
g12762.t1hypothetical protein
g12763.t1 conserved hypothetical protein

Sequence
29979 bases(100 bases per row)
CCTCCCCATCCCCCCTTCAACACCAGAATTGGTGACGATCTCATGGCGGTCACCAACGGAGCCCGAGCGCCGGCGCTGATAGGCCCCCCGCTGGTGCAGA
AGACCCGATTGGCGACCCCGTGCCGCCGTCACACCCGGATGGACCTCAAGCAGCCGTCGCGTGGTTGTCGCCGCGCTCTTGGTCACTGGAGCGTTAGCGG
TACAGCCGATCAAGCAAGCCTGCAAGTCGAGGAGGAAGCCGGGCGCGGCGACGCGCAGCGCAGGGCGGTTGACTGCCTTCGTTGACGAAACACGCTGATC
GAAGAAGACCTCCGACACGCAGTTGCCGACACGCGGTTGCCGCGCTCGCGAAAGAAAATCTGTCAGCGAGGCGAGGACGGTGCAGTCGAGCGGTCGCGGT
CACGGTCACGAAGTCTGCCACTGTGTAGCACTGCTACAGAAATGTCCCTGGCTGGTCACATGAAATGTTGCCGCGCTCTTGGGTCGATCGGTGCGACCGT
GGATGCTCCAGGCTGGCCGCAATATGACAAGTTTTGCTGGACATTATTTTCTTGGAACATTGGACCGAGAAAACCGGTCAGTGACCGGGTCACAGCCACT
GGGGTGCACCTCTGAACGAGCTTTCTGTCCACGGAGGTCCGCGCTTTGAAGGCAAATCTTGGTGCAGCGAGCAGCAGCCAATGTCTTCCTCTCACGGCAG
TGACTCGAACGACGAGGATGAAGAAAAGGAGCAAGCCAGTGTTCATTCCCTCGTTGCCACTCACAACTGGGACAACAGCGTGAGCGCCGTTCGGCCTGAG
CTGGCAAGATTTGAGACTGCATTCACGTTGACGGCCATCAGACTGACGGTCAGTGACGGTGAGGGCTCAACCCCCCCCCCCCCGAACTCAGATGCTGCAA
ACCTGAACGCAGGAGGTCCAGAGACGCAAACCAGCCAGCTAACACCAAGAAACAAAAAACGAGGCAGCAGACAATTGAGCGCGAATCGCGAGAGATTGTT
TCTGACGCTGAAAAATCGCCCACAGTCGCTCTCTCAGCTACTGCACCTCGACCCGATCAGCTCCGGTGGATCATTCAGCAACAGCAGCATACATGTATAT
CGTATCTCAACAGCAGTCAAATGTCCAGCAGCAGGCGCAGGTCAATTATCAGAAGCGACTCAGTCACTACCGGTAGCGTTTCCTGTTACTACAGTAGACG
GCGACAGACTTTCGCGCTGCTGCAGCCCGATCTATGAATGCTTTACGTCCCTAGGCAACATGCTTGGCTTCATGTACCAACGTAATTCACTGCGCCGGCT
CTTGAGTCGCAGCTAGCGCACCTCAGCCTTCCCGAAGACGCACAGGTATCACTGAGCGTAGCCAGCAACAGGCGGTGGCTAAGTATGCTGACGAAAGAAA
ACGTGATGAAGCTCTTGGATTGGGAAAACGGAAAGTCCCTGCTAAGGGTGTCGTGTCGAAGAATAAAAAAACATGCTACTCCGCGCTTTTAGAGCCGATA
CGCATGACCTAAAGATTCCTTTATAGTTTCTTTTGGGAGTTTACTTGCAGAGGAACATCATAGATCCGACCGCAAACTTTGTCCGACAGAAATCAGCTTC
AAAGAAAAAAGCGTGACCCACGACTTCGCATGTTGTTCCCCTGAAAACGCCAACGTAGACTGCGAACAGTTAGATGAGCAGCATTTCACTGGAGCTGAAA
GTGCTCTAGCGTGCACGAGCACTTGGTGAACCAAGCATTTGGAGCAGCCTACGTTGATCACGACACAAACATTAACTATCGGATGGCCCAAGCGGATTCT
GGTTAGTTTTATAAATCATCTACATCAGTACAAAACTCCCTGTTTGCTTCATCCAGCATCTAACACACACGTGCTAAGGTGAAACCAAGTGCTTTTGCAC
AATAATTATCAATCGGTATTACTTCGTACTTCAGTATCCTATAGCGATATGATTTCCAAAAAGCGGGGTCAATGAGTTTTAACCTTGGTTGGCGACTTTC
AAAGCAAAATTGGCTTGAGTGACGAATTGGATCAAATATACATGTAGGAGTGCGTAAGATGGTATGGTTGTCAATTTCTAAACAAATACAAACCGTAGCG
ACAAGTTGTTGTAGCTGCAGTAGTTGAAGAAGATATGTTGATGTGCCAGCTTCACGTCAATCGGTGGTCAAAATGCATCTCGAAAGTTGACGTCAGGAAA
AGCACTGTTCAAAATGGGCTTGACTGAAGCCTGCCTTGGTAGCCCAGTTCGTTGATCACTGCTTCGTAGTACTTAACTATTTCAAAAGTGCGTTACAACT
CTGTGTGACCAAACAATTTAGGTGAGTCAACACTTGATAATTCATCAAACATGCTGCAGTGTTGACGAGACCAAGTTCGAGTCGCAGATCACAAAATGGT
CATTGGTGTTGATAGAACACTCCCTTACACACGCCTTGATATATTGTGGAAGGTATCGTGCTGTGCGAATGCAACCGAGCAATACACTGCAAAGAGCATT
CGCTACTGAGTTATTATTGGAGGAGTTGAGCATCTGAACTTTCGTCGTTCTCGAGTCTTGCTTGCTGGCTGTTGTTTCTTTCAGATCGATCTATGCAGGC
CTAGATAGTGGCATGATGCCCAGTCCAAGCATACAGTTAAACAGTATCCGCGATCTGGTCCGCCTCGCTGGACAAGAAACCCAGCTCGTCCTCTTCGCGG
ATGGAGGGGCAGTCGCGCAAAATAGCGTGCGAAATAGCCAGAGCTCCGCTGCATTTATAGTAAAGCACAATATTTAGCAAGCTGACCACATCCGCAGTCC
TAGAAATCGCTAGCACTTACCTGGCCGAGCAGATCGTGAACAGGATGGATCCTCCAAACACGACAATCACAGCGGCGCTCACTGCAAATGCAGTCGCAAA
GCATACGCGTTAGCACATTTCACGCTAGCTACTGAAGAATAGTGCACTAACGTACCACCGAGCATACCGAGCTTCCGCTGGTCGGGTGTAACCGTGCGCC
CCATAATCTTCGTCGGGTTCTCGGGCGACTCATTTGCCGTCGCGCTCGACATGTAAAGCCAAAAGCCTCCGAGGCAGATGAGCACAAAGAGGAAGAACGG
GTTCAGCAGGCTGCACCAAAAGTACAACAGTCAGCAACGCGTCCTCTCATCTCGCTGGCGACGCAATGCACGGCGTCGACGTACATGGTGACGACGCCCA
CCAGCGCCGCGGAGATGGCGTAGTTGGCGCTGAAGAACAGCGCGTTCTTGCGGCACCGCGAGGCCAGCACATCGCGGCCAGGCACATTAAACGGCTTCTC
TTCGCCTGGTAGGTCGATCAGCCACAGCATACCAGTTAGCATTGATAGAAAGGGACTAGGATGGAGGAGAGCGGGGAACCGCACCGAGTCCGAAGAACTG
GGAGATGCCGCGCACGTTGCGGATATCGACGGCCTTGACGAGCTGGTTTCTGATCTTCTGCAGCGCGTGCTGCGGCACCTCAATGGTGATGGAGCCCTGG
GGCTCGTCGGACGCGACCTTCATAGCGCTCATGGCAACGGCGGTGCTTGTCTGGTCGTCGAGGGAAAGAGAAGTGGCTTGGGCACAGAGAAACTGTTGGC
AGGCTCCGGTTGGCCAGAATAGCACACAACTAGCGAATCAAAAATAGGCTGAATTGGACCAATCGTTGGCCACCTAAGATCCTGTCCCTGGAGTGATGGT
CACGCTTCAACTTGCATTCCGCACTCGCTCAATCACCAAGATGCAGACGCGCCGCCAGAGCCTCAAGGCGCCGATGAAGAAGACCTACGAGCTGGACGAC
TCGCCAGAAGAGGACAGTGAGTGCGGATGCGCCTGCGCTCGCAGCTTCGACCGACCTCGGCTGGCTGATGGGCAGCTGCAAGAATAGCCGGCGTATACAT
GGGTCTTATACTAACGTCACGCCATGTCCAGGCTGCTCTTATGATGACAAGGTGGAGCTTGCAGCTAGGAATAGCTGAGTAAACACGGTTGACGTGCTTG
CTTTTGTGCAGGAGAACGCGGTGAATGCAGCGATCCCAGGACGAAACAGCAAGAGGAAGGGCGATTTGGAGTCTCGCTCCGGTCGTGGAGGCCTGTTAAA
GCGACAGAAGACAGAGAATACTGCGAACCAAGAATCACCACCAATATTCGCCTTCAAGACGGCGAAGACCTCGTTTCGCAAAAGGAAGGCGCTCAAGCTC
CAGAAGCAGCTAGAAGATGAGGAGAAGAACAAGAAGCGGATCGACGACTTGGTTGCGTACTTCAAGAACTTGGACGAGCAAAAGCTGGAAAGAGCTTGAG
ATTGGTTGCGGTGAGCTCACTCTTTTTTGTAATGCCAAAGTGAGTTGCTGAGCGATAACATCGCTCATGCCGACTGGGCAGTCGCTAGCGCAAGAAGCTG
ATCGCAATAGCGAGGACTTTGGTGACGAGTCCGATTCTCTTGCGCCTTCTTCGCCAGCCGGGGAGCGTCGATCGCTACCGTTTCCTTCAGAACATTGAAG
ACGGCCTCCTGCGCGATAACCAACCAACTGAAGAATTAGTACACCTCTACAGCTAAAAGAATCGTAAGGCGATTCAAGTTACGTTGTTGTGCGTCCTTGC
TTACCTGGATGTCGGGCTCAGAATCGTCTAGGTGGACAAAAAGGCAGTCCAACGTGTAATCGATGATTGTTCCTTGGAAATGCTCTATCGGCGCAGCTTT
CAAAAAGGTGGTAAACGTCTGACACGCCGCTTTTCGCACAGTGTCATTGCTGTCATCGAGGCGCTTCAGAATCTCGGCGTAGAGTTGATGAACTGGTTCC
TCTGTAGACAACAATCACAATAGCTGTTCGTGAGAAATATGCTCCCCCCTTCTGAGAAATAGACGTGCTTCATACCCCCCAAGCACCCAGGCAATGCTAC
GAATAGATATTGCAGCGCAAGGCAGACCAGTTGGCGAGTCTTGGCATCGCTGTCATCCATCGAGGATTTAAGCACAGGCAGCATCTACGATGATAGCAAC
AGCGCAGGTATTAGCACAAGCACTAACAATCAGAGAGGGTACTACCAATACACAAGCATTTACCTGAGGTGCAGTCTCAAACAAGCACGGCTGGTCGGCA
ATGCCGTGGCGAAGCAGCGTGTATGCACAAGCAACAGCTACTTTTCTGATGGGTGCAAGTAACAAGTCCAAGCATCAGTACTACAGGAAGATAACCTTAC
TCAAAGCATTTATCACTCACCTAATAGTTGCAGCAACACGCCCTCCACGCCACACGATGTTCGGAATGATAGTTTTCTGGAGCAAAGCAACACTAAATGG
CTTAAAGGCCTGGAAAAGTAGTAAACACAAGTCCATTAGACACGACATGAGCCATGAGCAAAAGCTACGCCGAGTGATAGCGTACCTGGCTGATAGCATC
CGTCCCTAGCATCGTCTCCAATAAAGCAAGGAAAGCGAGCCGGACATCCGCATCTTGAACTGGGTCGAGGTGCACCAAGAAGACGGGCACAATTTTCTTC
AAGTTTACACCGCATGCCTAAACGAAGCAAACCAAAACGACAAGTTAAAATGGGCTTCTAGCAGAGATACTAGAGCATAGAACGTATTATACCACTCCTC
CACGTCGACAAAGCGAGTCGAACAGTACGCAACTCGGGTCGCTTTTTTGCCAACTGTTTGCTGCTTCAGTGGGAAGCCTCATAGTATCCAGAAGCTTGCC
CATGTAGCGTGCATAAAGTACCTAAAGTCAACCGAAGCCATGCAAATTAGAGAGTACTTCACCCAAACGAATAAAATGAGACTAACCTCAATAGGCTGCT
CAATCTTGACAGCCAGATCCAACATAGCTTCGCTTGCCTAATTCCATTCCAACGACAGCGTTAGCACCTTCGCGCATTTCAGACCCAGCAATACGTCGTG
CAGGTAGTATACCGTCTCATAGGCAACTGATGACTCTGGTGACGCAGCGAGGAGGTGACTCAGCACCCAAAACAGTCGGAAGCAGATCTCATCTTTTTGC
GAGAGCAGCGGTGCAGCAGTCTTAATAATACTCGCGACAACGCCAGCCAATTGATCTTGCAGGTCTGATACTTCAGACTCGCGCAGACCAGCGTCACACA
ATGCCTCGGTGATCAGCTAAGCGGTGATCAGCACAATGATAAGAGCGGTTAGTTATAGTCTACGAAAGTTCTTACTGATGGCAATCCGTGCGTACCTCCA
GGTGAGCTCCAATCGTCTTTGTTGTCATGCCTTCGATACTCATACCCAGCAGGACTAAGCCATTCGTGCGGTGCTGCGCGGTATCCTGGCCGGCCAGCCT
ACCTGCCACCATTGGCAGCAAAGAAGCCAAAATCATTTGGGCATCCGCGTAAAACCCGACAACACCTGAGCAAGCCTTCACACTGTTGAAGACGGGTTCC
TCGTCGTCACGGCACGTCTTGCCTAACGCCGAGAAAACCTTGTCGAGGAATGGGTTCACGTTCTGCTCTAGCAACACCAGGTACGCACTGAGAACTTGTG
TGTAGCGTTCACGCACTTGCACAGTCCAATCCCCCGTTTTCTCGAGAAGAAGCGACAACACCTGCGCTCGAATAGTCACTGCAAGTTTCCGAGCTCCAAG
TGGTGGGCGAGTCTCAAAGAAAAGAGGTGGTGTGTTCTTCGCTGAGTCCATATCCACCTCCATCGGCTCTACATCGTCCGCCTTAACATTTTCATCTTCA
TCCCGAGCCTCCCAGATTACTGAAAGTTCATTCAGTTTAACGAGAGATAGCTGCCGAACCTCGGGAGCTTCATCGATGATTCCCGCCAGGAAAATGGGGA
AGATGGACGCTTCATACTGCTGAATCTGCTGGATCTGGGCTAACCACGCAGCCAGCGTGATCACTAGTTGCTTCCTCACGGACGGGGCATGGTCAAATAC
AACCTTCTCAACAGCTGGGAGAAGCACCTCCTTGATGAGCTCCGGTAAAGCCTCCGAGCCACAGGGAACCGCAGCTTCCAACGCCTGCAATGCGCATACG
CGCACGCGGCTGTGCTGGTGGCCAAGATTCACAACCATAGGTCGCACAATAGCGCCAATCTGCAAGGCCACGTCGCTCTTCCAAGTCGTCGAAATCAAGA
TGACGCACTCTGCTGCCATCTTCTTGGCGTCCGGGAACGGGTCCACCGCCGTCTTGCCCAATGCGTTGGCCAGCTCCGAAATAACGTCACGCAGTGACGT
CGCCGATACTGTCACTGCTGCAAACTGCTTCAGGAATGCGTGCAGTAGCTGCAGAACGAGCAGGCGGATCTCCTCCGTCGGCTCCGGGTACGGCAGCTTG
CCGAGACGCGCGCTGGACAAAGCCACCAGCTCCTTCAGAGTCGCGTCCGACGGCTCCAGCGCCCCGTTCTCGCACAGGAACAGTAGCGATGTGAGCGCTC
GCTCGCGGCATTTCTCGACGGCATCGCTTTCGGCGCATTGCAGCAGCGGGCGCTGCAGGTTGGTTACGCACAGAGCGCGCAGCACTCCAGCGGACACCCG
CGACGCCTCATTCTGCAGTGCGCGGTACAGTTTGTCCGCGGCACGGCGGCGCACACTTCGATCCGGGTCTGCCAGGCAGTTGACGTCACGCTGCATCTTC
ATGGACAGCATGTTGTACGCGGCCTCATCCTCTGGAGACAGCACCATGGCTTGCAAGGTGGCGGCGTCGGATCCAAAATGACCCGCCACTCAAGTCGGCC
ATACAAAAGCAAGTGATGTAAGATAGGGCAACTTACGTAAGAACTTTATGTTGCAGCAATGAGGTGGACAGCTTTGTCGGCCCTGAACCGGCAAAGAGAT
ACCATGTACACTGTTAGTTGCTCTATGTGTTTCTGCTGAAACTCATCTACTGTTTGTTGCCTCTATATGAATACGAATTGCTCAGATGCTTCGGACGCTG
ATTGTAAAATCGCCAGGCTTTGCTGAATCGAAGACATGGCTCACTTCTTCTTGCCCTGCACGCGTTTGCGGCCGTTGGCGGTGAGCTCGCGCTTTCGCAT
GCGGATCTTGGTCGGGGACACATCGATCATCTCGTCCTCGCCAATGTAGGTCACAACATCTTCCAGGGACATCACGCGGATCGGAGACAGCTTGACGTTC
TCGTCCGTGCCGGCAGCACGCATGTTGGTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGCTGTGCTCACCCACGATCATACCCT
CATACACCTCGTCACCAGGCTTCACGAACATCTCTCCGCGGTCTTCAAGCGTGTTCAACGCGTAAGCCTGTTTCCAGCAAGCCATATTGAGTAAATAGGA
TTGGGGGCACGAACGATCGTACATTTAAGCTATCATCTTCCCGTGCACATGCCTCCAGACGAGGAGATAAGCTTGCCCTTCGACGGAGGAGTAGCCGAGC
CTTGGAACGGTGAGTAGCCGTGGAAAATCGAGTTCAGAATTCCACTTCCGCGAGTGTCAGTCTTGATCTACACATAGGAAACATGATCCAGAGTAAGTCC
TTATTCGAGAAAAGTGCTCGGATTCAACGCATTTACGCACCTCACTGCGGTAGCCCATGAGACAGCGACTGGGAATCTTGAACTGGAGGCGCACTTTGTC
GTGCATCTCCTTGAACTCGATGATCTCACCACCACGGGTCGCCAGCTTGTCAATAACCGTGCCAGAGAAATCGGAGTCGACATCGATCGTCACTTCTTCG
ATAGGCTCCAACTTCTGGTTGGTCTCCGGGTCCGTCTGGAAGAGCACCTGGGGGGCTGAGACAGACATCTCAAAGCCCTCACGACGCATTTCTTCAATCA
GAATAGCAAGCTGAAGCTCACCACGGCCGTGCACATCGAAGGCCTCCGACGATTTACTTTGAGAAATGGAGATAGCAACGTTGTTCTGAAGACATCAATA
CACAATCATTCATCAGTGAATCACTCAGCTCAACAAAAAAGTAAGAAAAGCAAGATCCCACTGACCTCGCATTCGCGCTCAAGGCGCTGCTTGATATGAG
AAGATGTGAGGAACTTTCCATCCTTGCCTGCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGCGGGTCCAGCTGCGGAGAGGGAATCGG
CTCCGTCACGGCCACGTCAGCGATGGTGTCGGACACATACGCGTTGACACCAGCAATGGTGATAATGTCACCTGTTACAACGAGTTAAGCACAAAACATG
AAGTATTAGCATGCAAACGCCTTCAAGCATAAAAGAGTGATGCTCTCAAACATACCAGCGGTAGCCGACGTGATCTCCGACTTCGAAACACCACGGGTCA
CGAACATCTTAGTCACTCTGCCAGTCTCAAGCTTCTTGCTCTCGCGGTTCATCACTTGAATCAAGTCGCCAATCTAGTCAATGGCACAGTGAAAAAGCGC
GGCACATTCAAAAGTCAGTACGAAGTGCAAGAGCATCATCTAGAACGAGCCAAGCCCACCTTGACAGTTCCGGCGTGTACGCGGCCTGTCGCCAGACGGC
CGACGTACGGGTCGTGTCCGATCATTGTGACGGCCATCGCAAACGGTTTGTCGGCGGTGGCTTCTGGAGCAGGCACGTAGCGAGTGATCTCGTCCAGCAA
CGGCAGCATGCTGTCACGCGCCTCACCGTTGTCCAGGTCGTGCACGGCCCAGCCCTGTTTCGCTGACGCATACAGCACAGGAAACTCCAGCTGGTCGTCG
TCGGCGTCAAGCGCCACAAACATGTCGAAGAGCTCGTTCTCCACAGATCCATCCAGACGGCTGGTGTCGCGGTCCACCTTGTTGACAACGACGAGTGGCT
TCAGTCCGCGGTGCAGCGCCTTGGTCAGGACAAACTTGGTCTGCGACATGGGGCCCTCCGTGGCATCCACGACCAGCACCACGCCGTCCACCATACTCAG
GATGCGCTCCACTTCGCCGCCAAAGTCGGCGTGACCGGGCGTGTCCACGATGTTGAGCACGTGGCCGTTGTACTCGACGCGCGTGCACTTGGACATGATG
GTGATGCCGCGCTCGCGCTCCAGGTCAATGGAGTCCATGACACGCTCCTCGGAGAGTGTGTTGCCGCCGTGCTTGAGCAACTGGTCCACCAGCGTGGTCT
TGCCGTGGTCAACGTGCGCCACGATGGCCACGTTGCGGATGTTCTCAGCCGTGACGGCCGAATAGTCGGTGGAGAAGGCGCACGCCAGCGTGGGCGCGCT
GCGCTGCAGTATCGAGCGCTGGCCCGAGCGCGCGCGCGCCAGGGCAGGCAGGCAGGACCGACGGAGCCACATGTCGAGCAGGTGCAAGCGATTGATACAC
GAGGTCGGGTGATGTGCGTGTGTGGTGCAGAGGCGTCAGCGACCAGGTGATGTGGACCACGTCACAGTAGTGTGCTTCACGCCATTTCGGTGGTGCAGAC
CTGGTACTCTGTACCATCGAATGGATTTGTTTCGCATCAGGCTGCTTGGGGAAACTGAAGCTGCCTCACTTCGTCAAACGGACGAAGCGCGTTTGTCAGC
GTGACTCGAAGGGCCTACTAGTACACACTGCATCTGAGCAGGTGATATTACCGTATGCATGCTTGACAAGTCCGTCTTTTAATAACCTGCGAAGAAAATC
GTCAATTGACGCGACGGTGACGAAATTCGCGGTGACTCGTTCTGTGAGCAACTCTGTAGCAAGAAGCGACGCGAACCACCGACCATTTATACCGGTCCTT
CGCAGTCCTCTCGTTCCTTTCGCGCGGTCGCTGAGTACAGGTGTCTGCCCTTTGTATCTTGCACCAAGGCTCACAACATCGCGAGGCACCTTTACTAGAC
TCATCCGATTTACCGCAGCCTACAATCAGAAAGCTGCAGCCTGCAGTGCAGGCACTGTCACTTGCGACGACTCTGCTTACTTGCCGCCACCCGGCGGTCA
GGTTGGCCGAGGCAGGACATTGGACGCGCTTACAATCGAGGGAGCTGCGTCGTTCCTTACACTCGAGGGTTCGATTTGGATTAGTGTACACCACACCAGG
CGTGTCAAATGGCTACCGGTACATGTAATCAGGCGCGTCACGCTGAGCCGAGCCGAGTACGCGGCCGATTCTTGGCCCGCGTTGCACCATGTTGGGGCAA
GTGCGTGGCGGCGAGTCGCCGCTGTCGAGTTCCGCCTCGATTGAGGAGACTGCAGTCATGGCGAGCTCGTTCTCGCTTCGCCATCGGTCTGTGGTGCTTG
GAAAACATGAGCAGGATGCGGCGCCGCGTCTTTGGAGGCCAGTGGCTTCGCATCCTGCGATTTGAAGGACTAACTGCAACCTGCGGCCCGATCTCTGCTC
AGAGTCTGAGCCGCAAACAGCGGATCAAACACGCTCCCCGATCGTTGAGGCTGTCCATAGAGAACCACACAGACGCAGGGCTGCTGCTGCTGCCGCGCCC
GCGGGCAGTTTGTGAATCAAGCGCGGCCAATCGCGGCGGCGCGGGTATGGATAAATCAGGATTGCCCTCCTCTTCCGCGCTTGACATTGGTCTCTGCTGC
AATGGCAGCCAGCAAAAGCCACTTTGCCGCGACATTCGCGCTGCCAATGCCTTCGCTCGGACCGGTGAAAATTCAGAACTGTTTGCGTGCGAAGGTCGGG
CCGAGGGACCAAACGAAGGGAAGGCGGGGCGGATACATGTGTCCACCCGCCTCGCGGGAGTGCACTACAGGTCGTTTGCTTGGTGCTTGGTAAATAAGCA
GTCCTTGACCAGTGGTCAAGTCCACCGTCAGCTGCAGATACCACCGTCCCCCCCCCCCCCCACCTTCTAAATTGTCTAGCGGGCCGGCTTTGCCTTGTTG
TTTGTATTCAGCGAGGCGCAAACCCGCAGTCCCGGCCCGGGTTTGTGCGCAGCCTCTATGCGATCCCAGACGTTTGATGCGGAAGATCTGTCCGAGCCTT
CATTCCGCATTTTGCAGGCCGGCGTTGCCCTTCCTCCTCCTCGAGAGTCCCGAAGAAAGCCTTGTGCGCAATGGGCCGGAGGACCTGCGCGCTGCTGCTG
CTGGCGCTCACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACACGCCACAACCTCACGGCTCTCCAGAAGCGGTGGATCGACCCGG
ACACGGACCCCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAACGCCAGCGAGATGAACGAGTACACGCTCAT
CTTCTCGGACGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTCGACATCCGAGATACGACCAACATGGGGCAG
CACTACTTCCTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGAAGCGCTACCGCGGCACCAAGTACGTCAGCG
GCAGCGTGCAGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGGCAAGTGGGGCATCCCCGGCACGTGGCCGGC
TATCTGGATCATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGCTTCGATGTCTGCGCCCCCTTTGTGGAGAAG
ACCGAGAAGGTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACCCGGAGATGTACGGCTTGAACCCGTTCCAGG
GTCGTGGTGCCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTCGACGTCGCTGCAGATCCGTCCTAGTCTGTC
TGAGGACATGCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGCGAATTCACGCGTATTAACAGCGACTACTAT
GGTGAGGTTGGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACTTGTACCGCCTGGATTGGTCCCCTGGTCCAG
AGGGTTACATCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTGGGTGGGTGATGTCCCTCCTCGCCAGCTTCC
TGTGGAGCCCAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAAGTTCTCCCCGCCGTGCGATGGTCAGATTTGTGACTCGATATGGCCCTCGAACTTC
ACGATTGACTATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGCGTATCCTACGAATGAATGGATCTACTCGC
ATCCGGTAGACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCAGTGATTAATGCTCTTGTGGGCTTTTTCAT
GGCTTTCCGAGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTTTTATGGAGCGATAAGTGCAAGCGCCCCA
GAAGAATTTGCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTCGTGTACCCGATTTCGCTAGGTGCGATGC
TTGGTTTGTATGGTGGCGTAATGATAAGCCAGTTCGTGCCTCTGCTTTCTACGCGGGTGATCACTGCTGTGTTTGTGGGTGTGGGCATCGCGCTGGGGTG
TGCGCCGCAGATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCTATCGATTTCGCTTTGGGTGAGCGAGGGT
GACATTGCCGACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTTTGCTCGGAGCACTGCTTAGCGATGTATG
CGCTTCTTCTCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCCATAACGCGATTAGTGCGCGCAAAGCTAA
ATTCCCGCAGGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAAGAACATGACCAACTTCTTTTCACCGAAC
AAGCTGCCGCACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGATTCCAACTTGACAACTTCCGCAACCAGA
CAGAGCACATCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATTTGGTGTTTTCTAACTATAACAAGTGGTG
CTCGAAGTTGAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGACGAGATCTCGGTGGACTTGTGCCTGTTT
TTCTTCATCTGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGATGAAGGAGGAGTTTCCGTCGGTTCGTCACT
CCGAACGCGAGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGATGTCGAAGCACGACCACGAGGACCGCCA
CAATTACGATGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGTTCTCGACATGACGTCGCCGAGCCCTGCC
ATGATTTACCAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGTGGTTCCAAGAGCGGCAATTTCTTCCAGA
AACGCAAGAGTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTACCGCTGCGCGCCTTCAACCGTATCTTCAA
TTTCCACGTGATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGACTTGTGCAAAATCACGTCAAGCACTCTG
ATCACACCCTTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGAGCGTTTTCGACGGTGCGTAATGTTTTGC
GGGTGCTTTTGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTCTGTGGTGGCAGACGTACTACGTCGTCAC
GGTGATTTTCCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCGACGTACTACGTTTGTTCCCATTGCCTTT
ATCCGTGATATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGCGTGGGCTACCAGTTTTTCTGGGCTTCGC
AGCTTTTATGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGTATGCCGACCATGTGGAGAATAACGTGAG
TATGATTACAACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCACGATTTGGAACTCGATCTGGATGGCTTTC
ACGGGTACCTTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTTAGCCGTGCTGTGGATGCGTTCAATGCAA
AGGTGATCGCTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCGCTGTTGGCCACGAGGTGCTAGATCGCGT
TGCAGGTGGCGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCCTCTGCTCTCTTTCTCGCGTCGCAAGCAG
ACACCAATGGAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCGACAGCATGCGCGCGGACGATTTGATCT
CGAACAGGGAGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTTCCAACTGGCTGGTTGCTTCGAAAACTT
CACTTCCAGCATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTTCTGGAGATTCTCAGTGAAAGTCCGATG
GTGGAGGAATCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCATGCCACAGCAACGATGTGAAGTACATCACGAGTG
TTCTCAACTCATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGCTTTGGCTAGCTTGGTGTTGTTATTGAA
GTCCAACGCCCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCGTACGAATTCCCGCAGCAGTCGAGCTCG
TACCGCCCTGCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTCCTCGTCGCAGTCGTGGTTCTGGAGTTG
CTCGTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCCGAGCGCTCACATCATGCAGATCCGCGA
GCGTGTGCGCACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACGGAGAGCAAGGGTATTTCGGACCGATTG
ACATGGATTCTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGTCGTTTGAAAGCCACACGGACGTGGTGC
TGTCACACCTGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCGTCTGCTGTTCTTCGTGAACTCGATGTT
TATGGATATGCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAGGACGTGCTGTACTCAAGAAAGGATCTT
GAAAGTAAGCAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGAACTTCCTGGAACGAGTGAAGCCGAAGA
AGAACATCTGGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTCGCGTACGGTTCAGGGTATGATGTACGG
TGAAGCAGCCATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACGAAGTTTACGTACGTCGTGGCTTGCCAG
ATTTATGGCCGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGAACCTCCGTGTTGCTTACATCGATGAGG
TGCGCGTGAACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGTGCATGAGATCTACCGTGTGCGGCTGCC
AGGCAACCCCATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAACTTGCAGACAATTGATATGAACCAAGAC
GGATACCTCGAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGTTCACAATCGTGGGCATCCCAGAACACA
TTTTCACGGGTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCAGCGTACACTGGCGCGGCCACTGCGCAT
GCGTCTGCATTACGGCCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCCAGCAAGGGCATCAACCTCAGTGAAGAT
ATCTTTGCGGGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGGGGCGTGATGTCGGTATGCAGCAGATCT
ACAAATTTGAGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCAGCGACTGGACTTCTTCAAGCTGCTGTC
GTTCTACTACAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTATTGCAACCTGCTACGCGCTTTGCTTTCA
CTTGAGGGTGTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCTTCACGACTGCACCGCTGCTGGCAACGA
TTTCTGTCGAGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTACTTCCTGTTCCACATCGGCACGAAGTG
GTTCTACTTCGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAGCACTCGTCTTTCGACGAGCTCTACCGT
TTCTACGCCAGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTTGGCTTCCAGTACTTATCGACGACGT
GGTCGCTGTGGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTGACGTGATGGAAGATTTCCGTTTGTG
GTTCAAGTGGATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTACTTCTCAACGCTCCGTCCGTGGTCC
AAGGCGTGCATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATATCACTCGATCCTGACTGAGTCGACGT
GGCTTCCGTTGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGCGTTCCAACGGTGAGAATGGACTTGT
TCGATTCCTGAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTATGTGGCAGTGTCTGCTGAGCATGGGA
TACCTCGCTGCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTACTTTGTGCACGATGCTGTGCTCGGTT
TGGTGTCGTTGAGTCTCATCCTGTTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACAACAATGCGCTAAGCCGCGGCGTGGT
CATCGAGGACATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTCGATCATCATGGAGCAGCAACGATTC
ATCAACGTACTGACTGCCAGCGGCAGTGATGCCGACATACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCACGCTATGAGCGACAACACGCTTA
ACGCGGTGTTGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATGTCGGAGGAAGAACGCAAGGTGGC
GCATCGCAAGAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAGCCTTCTCCACGAGCGATTTTTCG
GCCATTCTGCCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGGCCACACTGCCGTGTAGATAGTTA
GACGAACTAGTAGGTAGAGCCATTGACGATGGCTTGCTTTGCATTTTGAATGAAAGCTACTGTACCTGTTGATGTTCACACTATTCTTTTGTGTTGCGCG
CATGCATTGCATCCTGGTTACGGTGATGTTATGGAGACTTCGCAACCAAGTGATTTTCGGGGATAAAAGAAATTTCAGTGCAGGGCCCATTCAAGCAGCA
GGAACGTGCCAGGTCATGGCAATAGCAAGTGCATGGAAAAGAAGTGAGACCAGAAGAATCCAAGTCTTCAGCCTGGCCATTTGTCATAGCATTATGATGA
CTACCGATTCTGCAAAACCAATTCCAGCTCTCTCCAATTGGAGAATTCAATATCAGCACAACCCCTGAAGAACAAGTGAACGGAGGATGGATATTACTGA
AAGAAGAAAAAAAGGCGTTATGGAGTGACAGCGACGAGCATCAGTTTTCCAACCCAAGGCACCAGACACGCCAACGCGGTGAAAATGTTGGACAATGGTC
TCCGAGTCTTCAAACAAATAGGCGACGCAACAAGGACATATCTCCGAATCGACAGTGTGGATAAAACAATTCAGAAGACCCTCAGTGCAAATCCAGACAC
AACTTCAAACACGGGCCACGCCCAGGAACTGGGCTAAGAGCTACAGCGTTTTTTCGATGTACAACGGAGCACACCAGCAAACACGACCTGGAAGCAATTC
GGACACTGGCGAAAACACAATTCTGTCTCCCACAACAAAGAAGAACACCGGATCCGCTGCAGGACTACCTCACCAACTTCACGCAACAAGATTCAGCGCC
GCTACGTCAGACGAATGACGTCTTTTATATTATCAAAAGACTTCTATTGAAAAAAAAACACGTAACAGCAAATAGAAGACCACTTATCATCGCATTGCAT
TCCTGGTTGTGTACAGATAGCACAAATGCTTGATTGTTACTACTGTAGTGGTGGATACGCTACGAAACACATACGTCGTACATGTACTTCGCTGAAGTAC
AGTAGGTAAATACACACATAGATTCCATCAGTAGCGTCAGGGCTCTAAGTGCCAGTAGGTAGCAACAGTTTGGCGTCGAGAGCTCAACGATCTATCCATG
GATAGCGCGAATCACTGGTCGGACTGTTTCCTGGGCTTTTTTCCGAAGCCGAGGAACTTCATGTTGGCGCTCAACTTTTTCGACAACGAGTTTTTCTGCA
GTGGATCAGCGCTGGTCAGCACAGCTGCCTTGAAGTTCTCGGTCACCTCGAGATCGCAGTCGCAAGCCTCTAGCTTCTTTTCGATCTCGTCTAGGTTCTT
CTCCGAGACTGAGCGGATCACTGCCAAATCATCGACAAGCTGCGATGAAGACACGTGGGAGTAGATCTTGCGGCTGTCGGACGCGAAGCACTCGTCGATA
TCTTGGCTCGGAGACATGGCCAAATTGGCGAAGAGTTGCTGAATTGCTGGCGAATTCTTCTCAATAAATGGATTGAGCACCCTAGACATAAGTCAATACA
ACATACATGTGTTAGAATGCGGCACCAGTAGCAACATTCATCATGTGACGCCGAGCGTACTTGAATTGGGGCTCCCGATCTCCAAACTTTACACCGGTCG
CTGTCTTGAACAGCAACTTCGTAACTAGCACGAGCACGCGCCGAGTCTCCGGTGGAGGAAGCTGCTTTGTGAGCCCGTACAAATGCGGGGTAGTGATGGC
TGGGCACACAAATCGAAGGAAGAGGAATCCTCCGATCACCGACCGAGTCAGCGTAGACGCGTCTTCAGCCTCAACGCCCTCCTTTGACCCATCAAATCGA
CTGATGACCTTCGAATTCAGATCGGAGCAAATGTGGAAATACGATGACGGGATCTGCGAGTAAAAACAATAAATTTGGACATTAGAAACTCCTCTTGTAC
ATGCCAACGTCGGAATAAGGTACTTACGCAGTGGGTATTCTTCATGATCGAGTCGATAATGTTCTGGCACGTCTTCATCAGGTTTGCAGCGTTGGAATAT
GCCTGAGCTTCGTCCTGGAGTGATTCCTCCTTGTGCGGGTTCAACTCCATCTCGGCAATTTTCAACTTAAATATCTGGTGAATGGGATCTGAGAGTGCCA
CACGGATAAATTTCGACCCGATCGCTTTGCTGTACGTGGAAACGAGTCTGCTCGCATAATCATCTGAGCGGAAAAGTGTAGCCACGTTGATGACTGAAGC
CACCTCGATTTCGATTGCCCAGCGAATAAGGTGGCTAAGGCGGTTGCGACTGCCAAACACGCGGAGAAACGGAGCTAGTAACAGCATCTTGTCTTCTCGT
CCCGCACTCTGGAGAATAGATGCCACCACAGACATAGTGTCTTCGATTACCAGTGAGGGAAGATCTTTCGGGGTCTGTGGCATTGGTGCCCGTACTGACA
CCTCAAATTCCCCGTTCAGAAAATCGCGGGCAGATCTTGCATGGGAAAAAAAATTGCGTATCCTTGGGCTTGCACTGGTACTTGAGCCTGTTGCAGGCGA
GCCCGTTCGTAAAGCACGCTGGTGATGAGCCTCTTCTAGATCGTCCGTTTCCTTTGATGGATCGGTATCAATTCTTTGCCGAATCTCGGCAATAATCTCA
TCGCTGATCACGAGCTGGTCAGGCTGACGTGATTTCTCAGGCTGGGATGACACGATGAAGTCTTTCATGACCTGATGAATCGAGTCAAGAAAGCCGCTCG
CCTCCAAAAACTGACTGTCAGACTGCAGATTACAATACACATACAGTCAGATTCGAAAGCATGCAACGTAAACAGACTACCGAAAGACGAACCGCATCAA
ACTCTGACAGGCGTTCAATCTCGCCCTCCTCGTCGTCATCATAGTAAAGATCGTCTTGTGTGATGGAGAAGATGCTATCATTACTGTCGTTCGAGTTGAT
TTGATTTAGACCAAAATCGGTGACATCTGCAGATGTAAAAAGAAAAAGGAGTTAGAAATCCACTGGAGAATATTTAAGAGCTTCTAGGCGCACCTGAAAA
GGAAGTCTGGGATTCGAGGAGCGATGAGGAGCTTGAGGTGCTTTTCAACGGAGTCTGAAACATAGTAACAAAGCGTGAGTTGGATGTGGACGAACTGTAA
ATGATAAGATGTGACCACCTTACCTTCAATGACTTAGGGTCTACCCGGAAGGAAGACTGCAGATTGCGCGCAATTTCGGCGAGCTCCATCGCCTGTTGCT
GTAAAAAGTCATTTCCAGCGCCGCAACTCGAGTCGAAAATGCCTGCACCAGTGTGTGAGCCCTTAAAACTGGAGGTGAGGGAGCCATCTTCACTGCTTTC
ACGTGTCGATGACGAGTCTGTGAGGTCATCTTTATTCAGGTTGCGCGCCATTTCTGCCAATTCAGCTGCTTGCTGTTGGATGGATTCGTTCTCTGCAGCG
TCATTGAAGTTAGCTGAAGTCGCACTCAACGGATATGTTAGCGACTCTGCAGAAACAGGGCTCGTCTTTTGAGTCGCAGGCGCTGCCACAGCCTCTTGCT
TAGGGAGTATGGATACTGGCATACATTCCTGGTGAGGAGATGCTGGCTGCTCGTGTCCTGCTTCGGTTTGATCCACTCCATTGTACTGCTCGTCTTCATG
GGGCGAAGGGACCCCCGCGGACTCAACCACCAGGCTCACATTTTGGATATGTTCCCTCCCGTCTTCTCGGCTTATATCACCCTGCGCAGCATCGATACCT
TCTACCCCGTCCTCGTGTTCATCTCCAGGTACTTCGTCATCTTCTGAAAGCACATCAGAAACGGCCGAGCCGCGAGACAACTTGGATATTTCCATCGCAG
CGTCGTCCAGCATGGCATCCAAATCCAACTCTTCTCCATCAGCATCGCCTTCCTTTCCATGACACTCCTTGTCCCCGTCATTTTCTGCTCGTGCCTCCAA
CTCGTCACTTCCTTTACGTCCCTGGCGTTCATTCCGTCCTCGATTTTTCACTTCCTTATCTGGCGCTTCAAACACCTCCAGACATTTCTGAAGCTCCTCA
ATCTCGTGCCTCTGCTTTTCCACCATCCGCAGAGCATCGCGCAGCATCTCCGACGTCTCCGAGTCGTCTTCACTGGCTCGTTTCCGCCGTCGCGAGAGAT
GATGTCTTGGCGACTGCAAGATCACCATCGACGAAGCAGACGTCGACGACGCCGAGCTGGAGGACCTTGACAGTCTCCTGGCTAGAGCGAGCGCCGCCTT
GCCGTCCATACTGTTCTTCCTTGTGGCCTCCACATTGCCCGCAGCTTGGCGCAGCTGCTCGATCCATTCCATCCGCGCCTCGTGGGACGGCGCGCGGAAG
AGCAGCACGCGACCACTGCAGGACGTGACTTTCCAGCACGGGCCGCAGTCGTCCCCGCAGTTGGCCGCGTCTCCGTGGCGGAAGATGCGGTCCACGGCCT
TGATATCGGCGTCCACGAGCGGCACAACGGCGCGCGGCCAGTCGCCCAGGTGGGCGTAGTAGTAGAGCGCGTGCGCGTGGATGCCTACGAAGAAGGGCTC
CCACGGCGACTCGAAGCGCCGGCCTTTCTTGTGCAAAATGCGCAGCGTCGTGCGCTGCTCCAGCTCCAGCCCCGTGAGCAGCAGCTCCGGGCACTTGACG
AGCTCCGGTCGCGGCGAGGAGCTCGGGGTCTCTTCCTCCTCGATGGGGATCTGCACCGTGAGCCGCGAGACGCGGCTGCCGCTCGGGTCGAACACCGACG
AGCGCATGATGAGGGAGTGCGTGCGTCGAGCGCCAAGTGATGGCGTCTTCGATGCCTCACGCCGGAGAGGAATGGCAGAGTGAGGAAGGGCAACGGCATG
TCCGGTGAATAGGGCGGCGAACCGGTGCAGTGGGCAGACGGGGCGAGGGGTAATGCACCCCGAATTAGGAGTCCGACACCCGCATTTAGATATGAACGCC
CGGCTCTGCGCTGGAGTCGTCGGTTCGTATCAGACACAGCAGGGCAACATGGCGAAAGAGAGACGACGACGAGCTGCCTGCCCGCGGCATTTGCTTGCCT
GGAAATCGTCGGCAGAGCTGCTGCTCCACGCGGGATAGAATTGCGGAGGTTTGCTTGTCGAGCGGTTCCCTAGATGCGAGCAGATCACCGCGTAGGTTGA
AATATCGCGCTCGTAGTCGCTGGCTTGTCCTCGCGGCGTCGGCGTTCCAATGCGGGCGGCCATAGAAGCCCCGGCGTCTTCGCCGACGCTTTACTGCGAA
GCCCACAACTCGGTCGTGGGCCACAATCACGAGCAGCGTCGCCGCCGTCGCTGACTCTCCGGCTTTTTTATTTGAGCTCGTTCAGCCCGATCTTTTGGGC
GTGCGTCACGCACTGCGGGGGGAAACAAGTACCAGTACTTATCTATACAAGTCTTCGCGGTGCGAGTCGCATCTCGTGCCTCACGCATTTCAGCGAGGCG
GCCTTTCACATCCCAAGCATTTCGCGAGCCTTTCCAACGCAGCCTCGAAAAAAACTTGGACGAAAGCCAGCCAGCCAGTGCAACGGAGCTCCTTGCCTGT
CAGGTTCAGTAGAGGAGGATGCCGCGTTTTGATATTCGCCAAGCGAGTCTCGGTGGAGTCCTCAACAAACTCGGCTGGGCGGTGATTACCAGCAAAAAGC
ACCCGTCGAACGACTCAATGCATCAATCAACGGCAGCGGCCTCGATCTCTACTGAGCTACTCTCTCCACAGAGAGCGTGACGCCATTCCATCCAGCACAA
ACAGCCTCATGGGTAGCAGCTGCAGCCAGCGAAATGCAAGGCATCAAGGCCTCCAGCTATTCATCGAGCCAAGTGCTCGACTGCTCGTCTACAAGACGTA
GCACGAGAAGTTGCTGCGAAATTGATTCAGCCAATGGGGTGCGTGCATTCGAATTTTGACCAATCGCCAAAACTGCGTAAATTTCTGTGCGCACTTTGTC
TCGTACTGCGAGCGCGGTCCGGTTCGGCGATGCGGTTCGAGAATCGGGCATACAATCAGCAAGTGCTTTGCGGGACCGGTCCCAAGATGAAGCGGAAATG
CTGTGCGATTTATTTTCTGTGGCCTCCGAGCGCTTGGCTACCAGAGCTCGTCCATTCGGCCCTTTGCCCAGATCAGCAGCATCTTACTCCCGTCTCGCCC
GGCAGCCATGGTACGTTTCTCACGAGCCTCTTCTCGAGATGGCTGCAGCCCTGCGCGACACGACGCGACGCGGGGGAACCGGGCGACTAAAAGGGGAGAC
GGCGGACAGCCCGCCAGCTGCAGCGTCCAGGTGGAAATCAGTGCGATCTTTAGCCCGTGTGGACGCTCGCAATGACGGCGCCTTCCCACTGTCCCCTGTC
TTCACGGAGATCCTCCTAGTCGCTCCTCCCCGCTGTCCTGCGTGTTCTGTGGCTGCGTTGATTCACATGATACAGACAGACGATTGACTGGATGGTTGGC
GCTGTGTGCACAGGCCAGCAAGTACCAGAACATCTTCGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGGCCACGCCTCCCCCG
TCGGCCCCCGTCGCTCTGAACAAGCCCGCCGCTGGAAACAAGAAGACTGCCAACAAGTCGGCCCCCGTCGGCGACAAGAAGGAGTCGCGTGGACCGCGTG
AGGGTGGCCGTGCCCCGCGTGACGGCGAGCGTGGCGAGCGTGGTGGCCGTGGCAACCGTGGACCTCGTCGCGAGTTTGAGCGTCGCAGCGGCACAGGCCG
TGGAAAGGAGACCAGCAAGCAGGGCGGTGGTGCCCGCAACTGGGGCAACAAGGCTGATCCCGCCGAGCAGTTGGCTGAGGCCGCTGCCCAGGACAGCGCC
AAGCCCGCCTCGGATGAGGAGGCCACTGAGGAGGTCGCCGCCGTGGAAGAGGAAGAGGAGGAGGTGCAGCTCACCCTCGACGAGTACCTTGCGAAGCAGA
AGGAGTCGCGCTCGGGCGACCTCTTCGCTGACGTGGAGGTGCGCCAGGTGGCCAACGAGTTCTCGAGCGCCGTGCAGATCACCAAGGACGGCAAGACCCC
GGACTTCATGGACTCGCAGTACGAGAAGGTCTACAGCAAGAAGACCTCTGGCCGCAAGAAACAGCTCATCACCGACGTGGGCTTCCGCACGGAGAAGCCG
GAGCGCTTTACGCGCGAATTCGACTCGTCGCGTGGCGGCCGTGGTCGTGGCGGCCGTGGTGGTGCTCGTGGCAACGGCCGCACCGGTGGCCGTGGCGGCC
GTGGCTCCAACGTCCCGAACGTGACGGACATGAGCGCCTTCCCCAGCCTCGGCTAGGGATCGCATCGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCA
GCGACATGATGAGTGAGATCTTCCACAAGAGGGCTTCTCGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCGACGAAAGATCCACCGGATAGG
GCCTCTGCGCGGCTGGTGTCTGCCTGACTGTGTGTACCCTCCTGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGG
TCTTCTCCTTGGTATGTCTATTATTCAATGCAGCAGGCTGGGCTTTATGCGAACGAAAATACCGTTTTATCATCCGTGGCCTTTGTTTTACTTTGTTGTT
GTTGTTGCGCGTATCTTCACGAACACGTTGCCGCTTATCTGCAGGACGTTACAGTGACTGATGTTCAGCAATACGACGTGCCTTGACGCTGTCTGGTAGT
ACTACGATGGTGCCGTGAGCCGCCCAATAAAAAGGTGTTTGCCGTTGGTTGTCAGTTTCCCACGCTTGAACACCCCAGCCTCACACGGGGGTCGTGCTTC
CACGATGAGCTCGCTTCCTTCGTCATCTTCATCATGTTCCCGAGAGAAAATGCCGCGGCCGGAGGGAAACCCATGAATCCACGTACCAATGAACTTCCGT
CCGTCAGGGGAAGACCACAATCCATAGCCGTGGACCTCGCCCATGCACCATTCGCCGTCGTAGACTTCCCCCGAGGCAAACGTCAGCGCGCCAAACCCAT
TTCGCTCGCCAGCTTTATACTCGCCAGCGTACACGCTCCCGCACTGGAAATGGTGCACGCCCTGACCGCTCAGCTCCCCGTCATTCCACATGCCGTGCAG
GGAGCCTCCTGAAAAAATGTACACACCTTTGCCATGCATTAACCCTTGGTGCCACGTGCCTTCGTGCGAGTCTCCACCCACCCACTCATACTTGCCAAAC
CCTTCGCGCTCACCCTTCACAAAGTACCCCTCGTACTTGTCCCCCGAGCTGAACACCTTGGTTCCCCACCCGCTCACCTGGTTGTGTCTCCAAGTGCCGT
CAACCATTTCACCTGAGGACAGGAGCTTTTTGCCTTTGCCATGCATATCCCCCTTCTTCCACTCGCCTAAACGAGCAGCACAGCGCACACACGGCTCAAA
GGGTGGACACACGGACATGGTGTAGATTTTCCTTCTCACCACGATAGCTGTCTCCATTCTTCCAGAAGAAGGTGCCGTTTCCATGCATCTACCATAAGTC
TCCCATCAGCACCCGAATAAAAGTGAGCAAGTACTAAAACCTTTTAAGTACCTTGCCTACTCGCCAATTGCCGACGTACTTGTCCCCATTAGCCCACAGG
TACGTCCCAGTTCCGTGGCGGTGGTTCTTCCGATACATGCCTTCATGGCAGTCTCCAGTACCTGCAAAGGTTTGCATGCCGAACCTGCACCAAAGGCCAA
CAAAACATTATTAGCAGACCAACGCGTTGTCCACCCGTCAGTGACGCTCGCACCCTTCGAAGTCTCCGTGCACCCAGCCACCTTCAAAAATGTGCCCGGA
TCTCAATATGTGGACACCAGTGCCGTGTCGCCTCTCCTCGTCATCTACGCTGCCTTCGTAGCGACTGCCGTCCGCGTACTGGACCACGACGGCCCCTCGC
GGCTTCTTCCGGCGGATCGAGAGAATCTCCGCGTTGCGATCGCCCGAGGAGGCAGCAGACGCGTCGTCCGCCTCGAACTGCGGCGTTGGTTCCTGCTTCT
GCACGCGCCCGGCGGCTGTCGGGTCGGCTCGGTACGCACCGAAGCGGGACCCGCGGCGTCGACCCCGGTTCCCCATCGGCAGTCGCGGATCAAAAGCAGC
AGTGCGCAATGTGTTCGATCCGTCGCTGTACTACACTGTGAGTGATGGTCTCTGACCAATTTGATCCAAATACAGGACTAAATACGGATACTGAAATCAA
GTCGCGACCGACGGACTTGATCCGCCACCTTATCAATATGTTTGTGGCACTCCGCGCGTTCCTGGCGCTCGTGTGGTGGCACCTGTGCCACTTCCTAGCC
TACAACCTGCACGTACGCGGCCTCAAACCGTCCAGCCAGTTCTTCCACAAGGTCGTGATCATTGGCGACGACTTTGCAGCAGGCATCGGAGACTACGTCA
CGATTGGCGGCGCTGGCGGCGGCATTGCCGAATACCTAAAGAAGGTCGTCTCGCATGACGACAAGGCAAGTGAAGCGCTAACGTCGAGATAAACTGCTGT
AATTGCAGCGCCACGATGGCCCTTGTTAGGTCGCTTTGCAGCGTGCTCGCAAGCTTACTCACAAGATACTTTCTGTGCTAACCGCAGGTTCGTCACAACT
GGGTCATCGTCAACGCCGGGGTACCTGGAACCACAACGGCCGACTGGCTCATGTCATCGCCGAAGAAGGTGCATCGATAGTAGCTATCGGAGACTTGTGG
CCTGACTGACAAAACGAAATGCTGCACACGAGTTAGTACTTCAAGAACGTCTTTACCTCGAGAGCCATGGCGGACGCGTCAATCGTGATCATCGTTCTCG
GATCTGTGGAGATCAAGTGAGAAGCGTGGAGGCGCTATTGCATTGCGCAGCGAAGCGCCATTTTTCTAACATTATTGTGGTTGCTGCTGGCACCTGGATA
GAAACCCAGCTGCCGCTGGACACGAGATGAAGCGCCACCTCATGGAGATCTGTGATACTTTGCGTAAGAAGGGCAAGCAGGTGTGCCTGGCCACTGTTGC
GAGCCCCGACCCAACTGCTGATGAAACGGACACCGCCAGCTCGACCCTCAACACGGCACTGGAGCAATTTTGCAAGAGG