Description :
From Genome Similarity Track
Location :
scaffold_24:36369- 38230
Transcript NameFunction/comments
Plaha_PHALS_09961Phosphatidyl inositol kinase (PIK-B)
Plaha_PHALS_09962phosphatidylserine synthase

Sequence
1861 bases(100 bases per row)
ATTTTTACTCTCTGTTGAGTGGGGTAATCGAGAGCAGGTGCTCGAAACCTATCGAATGCTCTTGCTTTGGAAACAGCCAACCTACCTTCAGGCCCTCCAG
CTACTAAGTCCACTTTATTCAGATCCAAAAGTTCGAGCTTACGCTGTGCGCTGCATGCACGCGTTGCCCGATCATCGATTACAGCTGTACCTTCTTCAGC
TTGTTCAAGCGCTTAAAAATGAACGATACCACGATTCAGCATTAGCTCGGTTCTTACTCATGCGTGCTCTCACTAATCCTTCACAAATTGGCTACTTGTT
GTATTGGTTTCTTAAAGCTGAAGCACataatccacaaacagccgAGCGGTTTAATCTGATCTCAGGCCAATATCTACAGCTATGTGGGAGCTACAAGTTA
GAAATCCGTCAATCGGTGTATGTGATGAAGAAACTCGAagaagttgctgcatgtgttAAGAGTGAATCGTCCTCATCTGGTCGGAAGGAGAAACTTTCTA
AGGCACTGGAAGCTGTTGTCTTCCCTGACACATTTCAACTTCCATTACAGCCAAGATCGTATTGCACTCGCGTGATTGTTGAGAATTGTCGTGTAATGGA
ATCAAAAAAGCGTCCTCTTTTCTTACAATTTGAAAGTGCCAAGGCTCAACATGGTCGACCATATGTAATTTTTAAAGCTGGCGACGATCTTCGACAAGAC
CAACTTGTACTTCAGATTCTTcgcgtgatggatgatttaTGGCGAGAAGCTGGTCTAGACCTTTGTCTTCTACCATACGCTTGTATCTCAACAGGTGATG
AGATTGGCATGATTGAAGTGGTGGGTGATTCCGAGACACTAGCGAGCATCATTTATGCTCGACATGCGAATGCTCGAACAAAACTTAGTCGCAAACTTAG
TTCTGCGAAAGACGCTTTATTGAAAGATGGTGTACTTTCAAGTTGGTTGTTTCAAAAGGATAAAGGAAAAGCTACTTCTAGTCAAGAATCTTTCGATTCG
ACTTTATTACCTCCTTCCGAATTGAACAGTCCAATGAAAGAAGAAACGCGTTCAAAATCTGTTTCATCTTGTTTTCCAATCTCTCCACGTCGACGCAAAA
CATCGCTATCTGTTCGAGGTTTGGAAATCACGCAAAACTTTGTGCGTTcttgtgctggatattgcgTAGCTACTTATGTTTTGGGGATTGGCGATCGCCA
TAACGATAATCTCATGTTACAACGTTCAGGGAAGTTCTTTCATATTGATTTTGGGCATTTTCTGGGGAATTTTAAGTCAAAATTAGGGGTCAAAAGAGAA
CGTGCCCCATTTGTTTTTACTCCATCGATGCTTGACATAATGGGAGGAAAAAAAAGTGAAAATTATCAACATTTTCAACATTATGCTTGTGAAGCTTTTC
AAGTCTTGCGAACAAACTCGAATCTTCTCATTACGTTGCTGGTTCTTGCACTTACGTGTGGTATTCCAGAACTTTACAATGTCGATTGCATCAAATGGGT
ACACAAGACTTTAATGCTCGATTTACGTGACGATGAAGCTCGTGATGCTTTCAAGAAACTTATTCATGTAGCATTACACACTACGGCTACCAAATTAAAT
GATGCTGTGCATCTCATGGCGCATTGATTATGTGGCCAACATAGCACTCAAATAGctcttttttaatttaaaatcTAAGCTTTAATTTGTGGTTACCATT
ACCGTATCCCTTAAATTAAAAGTGATGTTCTTATAAGATTCAAACGTTGCGAAAAGTTGCCGTGATTTTAGATGGAGGACGAGACGGCGCAGCGTACTGT
CCTTCGATCTCGCCGTGACTCGGATCTTGATGATGCTCCGGAGGTTTATGGCACAGATCCA