Description :
From Genome Similarity Track
Location :
Scaffold_80:36369- 46793
Transcript NameFunction/comments
Phyta_totarag3108glycoside hydrolase, putative
Phyta_totarag3109conserved hypothetical protein
Phyta_totarag3110hypothetical protein PHYSODRAFT_293856
Phyta_totarag3111hypothetical protein PHYSODRAFT_525912

Sequence
10424 bases(100 bases per row)
CGTCAAATAAACCATGAAACGCTTCATTGGAGAAGTGGTCACGGCGCTTGTACCTGCCGTGCGCACTACAATATAGCTGGATCTAGCGCCTCTActgggc
agcagcactcaCTTGGATGTTGCCGCCAGCCTTCACCTGCTGCGCCAACCTGTCCGTTTCTGAGAAACGAGAGCATGAGCATCACAAGTCAAACACGTGA
ATAATAGAGCTTAGACCGAGTGATAAGAAATGAAAGATACGTACCAGCTTTCTTCTTAGCCGCCGCAACACCGAGAGCGATGAACACCACCGCCATGACG
CCCAAGAACACGCCGACGCCCACAAAAATGATCTGAGGGGccgagttcgagctgcttAACGTCGCGCACGAACTAATATCCTTAACACTGCAGTCAGTAC
CAGTGTAGCAGGACAGGCAGCTGCACGACTTCGTGCCGTTCGATTCCTTGCACTGGCCGTTACCACCGCAGTCGGACGTGCTCTCGCAGGTACCACCGCC
GCTCGTGACTTCGTACGTGCCGCAAATGTCCTCCTGGGTCGTACCGGAGGTACTGCTCAGGGTCACATCACACGTGTCGCCATCGTCCGTGCAGATCACG
CCTTCACGACTGGAGCAAGTCCACGAGTCTGTGCTGGCGATCTTCAAGTTACTCGCTGAACAGCTGCTCACGATCCAGCCGTACTTCGTTGCCATTTTGT
TGGTAGACTGCGTCTTTGTTTCTACTGTAGGCTTCCACGTGCACTTAGTGCTATCGGTCCATTCTGCATCGTCCGTGTAGCCCGCGTACTTGGCAAACTG
GGCTTTCAAGTTCGTGTAATCCGTCGAGGACTTCGAACTTGGCGTCGACAAAAAGTCCGTGCTGCCACCTACAAATAGAGAACAAAAGTCAGCTTATCAA
ACTAAAGTGCTTGCGAAAATCGTGCGGCAAATTACCTGTGAACATCGGGAACAGCGAGTCTGTCGCAAGTTTGGCTTCACCATACGAATAAGCCAGACCA
CCAGACCAAACTGCCGTAAACTCCTCTGTCTTCGAAGGTtcttggtacatgtacggaATCATTCCCCAGTCACGAGGAGTTGCGGAAGAAGTCTTGCAGC
CGTACTCGCCGAAAGCAACGACGATGGGGATGCCCTGCGCCATGCTGATGTAGCGCTGGTATGCCTCCGCGAACGTCGAGTCCGGGCACCAACGGTACTC
GTTGATCAGGTAAATATCGATACTCTCCGCCATCATACCGTTCGTCATTTTGTCTCCGCACAAAAGTCCCTGGACCTTAATCACGTGATAGTCATCGGCG
TTGCTGACCTCGTCGTTACTACTGTCAGCAGCGGCGTAGGCAAGCGGCAGAATGCGCACCTTCTTGCCGTTAACCGACATCCAGTTCTTCAAGTCAGACA
CGTAGGCCTTCACACACGAGGCGGCCGTCAGGTCCGCCTGCATGATTTCGTTGGCCACGACGACACCCAGAGTGTTGTCGTACTGCGCAAAGTTCTGAAT
AATCTTCTTGCCgtactcgagcagcagcgccgggtAGCAGGTCTCCGTCTGGTCCACCGTCTTGGCACCGTCGCCAGCGGACACTTTACCCGAGCAGCTC
AACTTCTTGGTGATTGTCGAGTAGCGGTACTTGCCGTAGTAGGCGTCGTTATCGGGCGAGGCAGACACCATCACGTAAACGCCGAGCTCGGCCATGTCGT
TCATGAATTTCTTGTACGAAGACGTCGGGTTGATGTTGTACAGACGCAGCGTGTTGTACTTGAGCCCGGACAAGTTTTTCGCGATCGTAGCCTTCGAGTA
CTTGTCGTAGTACTCGTCGCTCACTGCGTACTCGTACGTCAACTACATGGCAGCATATAGTGTACACATACATACATTAGACCCCCATGCTATTGTACCG
AACTGTGCTTTGCTGTTAGAGGCTGGCTCCTTCCTATCCTTTTCGGTCGTTCGAACCGCACGCACCCctttgatgaagaagcgctcgcCCGTCTTGGCGT
TGTAGAGCTTGTTGCCACGCACGATGATCACGCCGTCGACGGCTGCGGCCATCGAcatgtgctgcagcaaggcgAGGGCCGCCAGCAGGGCTAGCAGCAC
GTAGCTTGGTCCAGTCATGGCaagtcagtcagtcagtctCCCGGCTCCGTTTTTTCGCTATTGAGCGACCGGCCGGCCTTCCCTTTTTTCCTCCACTGCG
AACAGAGAATAATTTTCGAGCGGATTTTCTACCAGGTGGTACACCCATAACATTATAGAGATATTGTGTCAGTCGTTTCATCTGTGAACTTTTTACCATG
CAAAGGCTTTGCGTGCTAAACTCTATTTTACCTGTTATATCTGATTAGATGATGGCGATACGTTGTTAAAGGTTAGCAGGATTTAGAACAGGCGTGCGAT
TTGCCGGGATCGCCGATTGGACGTTAATCAGACGGAGATTTGTGACTGGTCAATACAAAGGCCAGTCTGATTCACACCCACTCCGTTTTCATCCCTGCTG
ACGGCGGCAGAAGACAGCAAGGCGAGCGTAGGGGTCCGCCAGTACTTCGTGCGGCGCTGAGAACACGATGCGGAAGTAGTTGGTCATTCCGAAGCACTGG
AGATAGCATAGAAGAACGAAGTTAGTTGACGCACCCTCGAGATGGTATCAATAACAACCTTTTCGCTACTTTACCTGTCCGGGCAGCACGAAGACGgact
cctcgtccagcagcttctgcgtgAGATCGAAGTCGTCCTTGATCTTTGTCAAGATGTCGATATTAAGTTTAATCTGCGGAGACAATGAAGCATGCCGAGT
TAATAGTCTATGTCCAAAAACAAAACTGAAAGGTACTTTTCAGAGTGCTAATAGACCGCTTACCATCTCGTACATCGCGCCCTGCGggaccaccacctcc
agacCCGGGATCTTCGAGATCGCGTCGATAGTAAACTTGGAATTGTCCTCAAGAGTTGCGAAATACTGTTTCCTGAAGGCAGCCAGCGACTGCGCCTCTG
CGCTCCCAAAAACTGGTGTCAGCAAATCTGGGATTCCGCTCTGCGGTGGTTTGAGAAAtcatcgacgagaacacggTCTTAGGCTTAGTACCAGTCGATA
CATCATGCATGGTGAGGAGGCTTTACCTGAACCAGTGAGTTTGCTCCAAGAGTACTTCGCGACAACTTGAGATAGGCAGTGCGTACGTCTTTCAGCACGT
TGTTGCGGTCGTGCACCATAACCCAGCCTACCCTCCAGCCTGGGATCAAAACTGTTTGGCCAAGCCACCCACTGCCACCACGGGGACCGTCTTCGTTAGC
GTCGCCATGGGGAACACGTTGCTTCCGAAAACCATGTCGCCATAGATCTCATCTTGGGGTTCAGAACGAGTTAGAAACCGCAAATTCTACAATTGAATGC
AGAGCTAGGTTTACCGCAATGACAGGAATCTTGTTTAGCTTTGCCAACTTAAGGATTTTCTCCAGGTGGGGCTACACAACACGAGATATACCGATACAAC
GTTAGAGGTATACACACCATTCAAGCGCCACGTTCAGGTATTATTACCTTCGAGTACACGCTGCCGCACGGGTTGGAGGGGTTATTCACCAAAATCGCCT
TGGTTTTATCGTTCACCAAAGACTGCATGTGCTCCAGATCGACCTCCCAGTTGTTCTGTGGCTGTAGCCGCCAAAATCACACGGGTCTTCAGTCCAAACT
CgtgaagtacatgtagttagtTCAGGCGCCAAGCCGCAACCTTACCTTCAGGTTGTAGAACCTGCACTCGATCTTGTGCGCAGCACAGAGCGCTTGGTAG
AACGGGAAGCCGGGCTTGGGGAGTAGAACGTTGTCGCCAGGGTTTAAGAGTCCTCTCAAGGCAATATCAATTGCCCCAGAGCACCCATTAGTGACGATAA
CGTCGTTCGACGTCAAGGGAGCCTTGCTGCTACCGTAGTGCTGCGCAATTGCTGTGCGAGCTACCTCGATGCCAGCGGAGTGAATGTAACCATTGTGCTG
CATTGAACTAACAAGCAGCAATAGAAGAAAACCATGAGCGCCCAGGTCCTTCAATAACATCGAGTGCGTTCAACTTACCGAGTGTTACGAACAATCgcct
gcaccagcacatcGCGGCAGTGCAAGTTGCCAAATACGGTGGGGTCACCTACAAAATACCGCCATCGCTTGGTTCAGGAGCTATCGCACGCCCAGACTAA
AAGTAGATAGATACCAACCAAGAGACAGAGGAATCAGTGTCTTGGTCGACGTCGCGGGTTTCTTGATGGTGTCCACGATATTCCGGATGGGGTTGGAACA
CAACTTGGAGAAGTCGGATGGCTGCACATTCCACTGAAGCTTGGATTGTAGCTTGTCTTCGACTCTAGAAGCGTCGAAGGTGGGGTTGTCGCTCTTCGTC
ATTGCGGTAGGGATACTTGATCCGTCGAGGTCAATTCAAATGTGAGTGTCATTGCCGAGGTCAGGACTATCATCACGTACAGCTTGGGCTGCCTGCCTAT
CAGCAAATGCAGCGGCGGTGACGAATGTCGAGTTAGCCAATCGGTACCATGTATTGGTTTTCGGTGGTAGGTGCTCTGCCGTCACTGTACTTGGTGTACT
GTACCAGCATGTGTGCTGGCTGTGTTGCTTTCCCTATAAGTTGACAGCTCTACGTAGTGAGACAAACTTAGTTTGAAAGGCAGTAAAGTGTACGCTCGCT
AACTTGTGTCCAAGTAGTATGCTGCGCATGTTATACTGAAATGCGCTGCGCTGGGTGCCGGGTGGAGACGTTAGTCATTCCGTGTAGCTAAGCAAGTTGA
TTTTCGCTGTCGAATGCTCCAAATTCAACAATAATGGCTCACGTAGAAGCAGGTGTGTGCAGTTAGCCAAATAGTGACTGGTACACTTCGACAGCGCAGT
CTTGGCGAAACTGTGCTTGTTTGGTCACAATCTGTTCCTTGATCGACTCTTCCTTGTCTCCAAGAGCACCAAAAAGTACGCCAAGGACATCAGGTTCCAG
GTCATCACTATCCCAACACTTGGCCAAAACAGCCGCCAGGTCCACACTTGCATTCGCAAGCAATCTTCGCCACTCTGCAGCGTGGTTCGTTGCCAGGAAC
CGTTGTGTTTTCACGAAGACAAGTCTTTCCAGTGATAGCAATACCCGCTCACGACAATCTTGATCTTTTGCTGCAAaaaatgctgctgccacgctGCTTT
CGTCTTCACAATTGCGAGTGATACCTGTTCCTGACGAAGACCGCAAGGCAAGCAGACGCGACTCGCATTGCTGCTTAACCAGTTCCTCCAGCATAACACG
GGCGTAGTAAGGCACCATGCGTTTATCTGCCACGAGTTCTTTGCGTACGCCATCCCACCAGTAGTTGACAGCAATGGTAAACTCATCTGAGTCCACCTGG
TGCCACCACCCCTCCGGGATCACAAGTGCGTCTGCAACGGTACGATCATGAATGCGTTAAATGTCACGGATAGGATCAATGGTACGACGAAGAGAGTACT
GCACCTCCAGCTGTGACTTCGAATCGCTGAGCTGATGCCTCGGAAAATCGCGCGTGTTTTTTGAGGTCCGGTTGAACGATGTTCACTTGGCTGTGATTCA
CGGACTGGGTGTGCACCGGGAATGGATACACCTTCGCGGTGTCTGACGGAGGATACAACGTGACAGTCTTTCTCCCAAACAAAACCACCAGGATGTTTTG
ATACGCGTCATAGTGCAGCGTCGTCCGGCCAGGTTGCACAGTCATCCACAGATTCACTTTGGTGACAGGTTTGTCATGAAGACACGTGGGTCTAAAACGG
CACACGAAGTAACCAGTCAACGCGATGATGAATGAAATTCCAATGCTGCAAGCACCTTACAAGCGAAAATCGTCCATGACGGCGGGTAGACTCGCGTTGG
CGCACGTGGCGTCAGGTTTGAGCACAGCTATGGGGCACTGGGCCAGGTAAAACTCCAGGTCGTCCACCGTCTGCAGCCAATGcgactgcttcttgaaggc
TGCTTGGTAGTAGTCCACGAAGTCGCCAAATTTTAACTCAACGCTCTGCCTGGCCTTCTCGTTGCCGTTATAGCAGCCACCCGATCGCTCTTTGCATGCA
ATTTCCACCACTAACGCACACTCCGTAAGCACAACTCATAGCAATTACATTATTAACAACGATCGCTCTGTTCTCACGAGTATCTCGGTGCAACGCATAG
GAATCCAGCAGGTGAATGGACTCTGGGGTGAATTTTGGCAGCTGGGTTGACACTACACACTGAGCCGCAAACTCTGCGAGGTAGATCGggtcgtgctcgt
ccatcATGATGATCAAAATACGCTcgtggtgtggtgcacacagGCGAAAATGGCAGTCATGCAGCATGACTCATGCTAATGGCAATCTATTGTTCATGGG
CTTCTACTATAGCTGCTGCTTGCCCCGTTCTGTGTTATGTGTGATTTCTCATGGCTTCTTGCTAtggtttgttgctgctacgATGCTAAGTCGATAAGCT
ACTCAGTTGTGGTTCTTGTAACGGGGTCGATGAGTCAGTCATGGGCTCGGGGATTGGCACCTTAGGACCAGCGGCAGACTTTGAGTGGCGCACGCAGTAT
CCGTGTCGCTGAGCCCACTTTTGACAGTCTTGTTCAGCACAGCGCGACCCGCCGCCGTGTGAACGGCAAAATCCCTTGGAGATGGCGCCCTTCGTGCAGT
CTGGGTGTTGGCATCGTACACCGCCGCCGTGCGTCTTGCAGCAACCACGAGACTGCACAGCACGGTGGCAACCCTCAACGCTACACAACTTTACACCTCC
GTGTGCACTGCACTTGTGGCCGAACTGCGCCACCCGCTCGCAGGCTGCCTCCGCGCACAGACGCCTGCCTCCATGCCCCGAGCAAGCGTTGTTGAAGCGC
GCAAACTTGGTGCAACCTTCCACTtcgcagcgccgacgacgataGCGCTtaggagctggagcagacgcCCCATCTTCGGCCTTTACGTTGTCTACATTGG
GCACCACCGGATTATCTGGGGCCGTCGTTGATTTGTCCTTATCTTCGGTCTCCTTGTTCAATTCACTCGTAGTTGCATCGGTTGTTTTCGTCTTTAAAAC
GGCAGCAGCATTAGTAGAAGCGTCGGCAGCAGTCGCAGTGGCCGTTGCAGTTGTTGACGCTTCATCCTGATCCGgattcttctgcttgtccttggccatc
ACGGCCGCTTGAAGCAGCGTGTCAATCCATTCACGAATAGGATGTCCTTCACCGTCCGTGGGAGGCTGCAAGGCTAGTGTGTCCTGTTTGGCAGGCTGGC
TCTCGGCCACCTCGCTCATTGCGCCGCCACTCGTTGATACTTGGGATATCTCGGTGCGCAAGTCACAGCTTTTTGCTTTTTAGTGGTTGACCATGTCGCA
GCTATTGGTGTGTGTTACATAAAATGATGTAACGCAACACATTCGAAGTTGAACTTGCTGGGCAAAaatggtgctgcagcttgctggtGCCTTCCGTCGC
GAGGCCGAGACGGACGGCGACGCAGGTTTGCATCCATGGGGATGTCCATTATGTGCAACAGGTAACGAATCTACCGACGACGACCCATCGTCGCGTTGCA
AGACGTGTCAGCGTTTGCGTAGTCCGCAATGGTTGCACTTGGAAGACTGGGGCCTTCAGGTGCTCTTCCAACTGTGGTAAATGATCCTCCTGGATTGATA
TCTGATACTAATACATTGCTGCGCTAGCTGGAGCTAGGATCTCGAGTGTTTTATACCAGCGTAGGTGGATCCAAGGCCGTGTCTGTCGTTGTAGCTCTCG
ACTACGTTCAAAAAGTCGCCACACTCCTGCGAGTGAAGGCCAATCGCAACGAGGGAGGCCAACGTGGCGCCATCAGCTTCCATGAGGTTGTGTTAAACGC
GTCACAGATGCAACAACAGCTTGGCCCTCTGGATGCTGAACAAGAGGGGGGTTGTGTGCTCGACAACTACGGCGTCTGTGGAGAGTGTCGTGGCATTTTT
CGCGTTGCCCAAGGAGAACTACAATATCAATACGCAAACGAGGACAGAGTCAATGAGCTTCGAAACAAGTTGCAGAAGttcagcgagaagaagaagctgt
ttgCCAGGGGGAAAAAGTATAATAGGGCTCTTGAGTGCACGGAGCAAATTAAACTTGTAACTaagcagctccaagtcgcAAAGCGCGAGCTAGAGTTCCT
TACTCCCGTGTTCTGCCCATTCTGTGGGTGGTCGCCAcgataaaaaaaatcaacgGTAAGAGATTGACACGAAGAGGGAACGACAATATGTTTGAGATAT
CCCCTTTAAATACTCAACGAGAACGTTCGGTCCTTCTGTCGGTGTCGATAGTAGAAAGTAGCATGGAAAGTCCGGTGCTTCCACGATTTTGATCCAGTCA
AAACCATGGTGGTAAGGTGAATTGTGCTCTCGGACGACGACTGTTCTGCGGTATAAATGGTCATTACATGACCGAGCAGCCGAACCACGACTCGTCCGAG
TCCTTCGCAGTCACGCCTTCCACATCATTGCCTAGGTGCTTCATGGCAGATGCGATATTGGTTTCGAAGTAAGGGTGCCACACATGGTCGTACAGGAATC
GTGCCGTGAATGAAAGGTCATCCTTATACGCTTTAGCGACCTTGCTGCCACCCCAGATACGGCTTCTCTCCACGATCCATGGCACCATAACACGCTTCGG
TCTAGTTGCACGAAAGATCCGCGGCATGACGTATCGCTGAAAAGCCTTCTCTGAAAATGCGAGTTCAATAGCAGGCTTGAAGGCTTTTTCTTCTAGAGCT
AGCACGTTGAAGAGTAGGTGATTGAGGCGCCGAATATCATCCTGAAGAAGTCCCAGGCGAGTCTGCCACGAACCCGCTGACGACGCAGCCGACAACAGCA
ATTCGTCCTCCTGCGCGATGATCACATCCACCAGCGCGAAAATAGCTTGATACAAGGCAACGATATCGCGCTTCTCCACAAACTTGATGACTACAAGCGG
GAGGAGTACCGTCGTCTTCACATCGTGCTGATTCCGTACAAATTCAACGAAGTGCAGCTTGAACCAGCAGAAAAACTCGCGCACGTTCCAATTCATGGGT
GACTTCAAGTCAAGGctgcgctgcaagaagcgaTCGATAACGAAAAGAGCATGACGAACCGGCTCATGCAGTCCCAGCAGAAACTGGGAGTTCCAGCTCA
TATCCACTTCGTCGTTGCGAGTTAGCACGTTCGAGAACACCACGTTTGCTCCTTTCCGATGCGGGGCAGAAACTGGAGTATTCATCACACTGGCAAAATC
GTCTGACGACAACTCTCTTCGGAGCGTGTTGGCATCCATCCTCAGAGGACCCAGACTCAGGATGCTTGAGGGTGTAACCACCGATGAGCTCTCCTCACTG
CTGTGCTCAGAAATGGGTGTCGATAGGTTGCTGGCGCTCTGTTGCATCTTGCTCATCATTGCAGCATGTTTGGCGTTCTGCTGCGATTCCAGCGACGCCC
AGATATTGAAAAACTCAGTGTTGGTCGGACCCTCGTAGCCGCTCTTGTAGTCAAGCGTCGTCAACACGTGCGCAACCTGGCTGATGTCCACGAGTTGCTT
TGACGTCTTGGCAGCAGGCACGTCACGTGCAGTCTCGGGTGGCGACCAGATATTCGAATAGAAGGCGGTCTCGTCGCCCGGAAGGCGTCGCGGTTTCTTG
ACGCGTTCGTTCGTGGCTACCATTGCCAAACGGCTTTTCACGAGCGGTTTGCGTTTGGGAGCGGCGACAAGCTTCATAGCCCGGCTCCGCGGGAACACGG
GGTCGTCTCGGTGAACGAGCTTCTGAGGTGAGCGCTCTCTGCCAGGCAAGTCGCTTTGCACTTGAACTGGCATGGTCTCCTCCCTTCTTATATCCCTGCT
TTTCTCTCCCTTCTTCGCTCTTTACTTGATAGAGAGGGCAGGTTAATCCACCAGATGCCGCGTGCTTACCACAACACGTAGCTAGCCGGCAATAGGATCA
GTGTTCGTGTCTGAAGTCTTGGCGTCGAATGACGAGGTTCTCTTAAACTGACAGATGGGGGCGGACGAGCTAGTGAGAGAAGCAAGGTGAGAACAGCGCG
TAGCACACACAAGTAGACTTGTCAAAGGAGAAACATGTGCAGCCGCTAACCTGTCTCCACAATCGTTACTGCCAGTTTCGCTcgaattgaagaatgagga
TATTTTGGCTGATGCGGCAGAGAGATGCTGCGGCTCGGGGTTTCATTACTGCAGTGTTGAGACTTGTTGGGGCAAGTCTCAAGCCAGCCAGATGGGAATG
CTACCGTGTCTCGGCATTCCAGAGAACGGTGAAAGGAGGCAATGGGTGTGCGAGAAGCACTCGCTGCCAAACAACCCACAAGAAAACCGATCTCCTTCAG
GTATCGCATTGGACCGAGCAGCTA