Description :
From Genome Similarity Track
Location :
Scaffold_14:36364- 38666
Transcript NameFunction/comments
Phymu_g1004conserved hypothetical protein

Sequence
2302 bases(100 bases per row)
AAAGTGCCGCTGACCAACGGGGTCCTGTCCTGCAATTGAGCACGTTGACTTCATGCCATTTTATTATGCGCTTGTGGAAGTTAAAGGCGCGATTTGGGGC
TCTGAAAATACCGTTTCCTGGATATAAATGCGCGATGCCAAGCTTCTCGTTGGTTAGAGCTATTTCGAGGCCAGGAAAACCTCACGATCTCATCGACACT
TGGAAGAAATAGTGACTATCGCTCTTCATTCTACATCGCGAGCCCCAGACTGTAAGTTGTGTGATCTGCTAAAAGCGGTTGGCCCCTCGACTTTACTAAG
AACACAATAGGAACGATGCTCAGAAGGTAGGCTGATAGAACGCGTTCTTCTCTAAACACTGGGTGACGATCTAATACTTGAGTGAGGTTATAGTCCAGAA
CGCCGCGAGCATGAATCATGCCCTGACCGTAATACCAACCAAAGTCAGGAAATTCGTCCGACATCGTTGCCAGCTCCTCTTTCTGGTGCTGAGGTGAGTG
GGAAAATAGGTTTTACTACGTTTTCTTTACCTCATCATTCATTAACATTTGTCAGGCTACTCAAGCGTTGCTGAAAGCTAAGATCCGTGAAATTCAGTCG
AGTCCAGTGCTGACGCCGAAGCAAAAAGCCGAGTCAGTGCAGAATCTCATGATGAAAGACTGGAACGATGCCAAATCGAAAGCAGGTGCTGCCAAAATCG
AATGTGATAAAGAAGCCGAGCGCAAACGGACGTCATATCATGTGCGTCAAGGAAAGAAACAAATTGTGTAGGGTCATTGAGCTGACTTTGATTTCGTGCG
TCGTACAGGATGAAGCTAAAACGATTTTGGGGTGTAGTCACTACCAGTACGCGATCGCTAGTTGTTGCTTTTAAACTATGTGAACGTCCAGCTAATTGTC
GTGCTAATGGCGTCCTTTTCAGGCGTAAATGCAAGCTGCTCGGCAAATGCTGTGGGAAATGGTATTGCTGCCGCTTTTGTCACGGTGAGTCATTGTCGAC
TTCTTGACGGCCGATCCAATTTCAAACTGACTTTGGTTTACAGATGACAGCGAGGACCACGCCTTTGATCGCTACGCTGTAGAGACCGTATCGTGCATGA
AGTGCGACACAGTCCAACCGATCGGGCAAATTTGCATGGACAAAGACTGCAAATGCGAATTCGGCCGCTACTACTGCGAGGTGTGCAAGTTCCTCGATGA
CGACAGTAACAAGGACATTTACCATTGCGACAAGTGCAAGATCTGCCGCATTGGCAAGGGGCTGGACATCGACTACTTCCACTGTGAACGGTGCAACGCC
TGCATGAGCATCACTTTGAAGAAACACAAGTGCGTAGAGCGATCGCTCGAGTCGGACTGTCCGATCTGCCATGCGTACATGTTCACGTCGACAACGCCTG
TCATGTTCCTCCCTTGCGGGCACTGTATGCACGTGTCTTGCTACGAGGAGTACACCCTCGTACGTGAACGTGGTTTCTGTGTGTTGCCTATATGCTGAGT
AACAGTTGTTGTGCTTTTTTGGAAGACGAACTATATCTGTCCACTATGCTCGAAGTCCCTGGGTGACATGGAGCTGTACTTTGCAAGCATTGACGAGCTC
CTAGAACGAGAACGAATGCCAGCAGAGTACGACGACTACAAGTCGCTGATCTactgcagcgactgcgaACGCAAGTCAACAACCAAGTTCCACTTCGTCT
ATCACAAGGTGCGAACCATGTTGCTATCGTTTCGAGCTAAAAATTGAGAGCTCATGCCTCTTGTTTCGGACTGTAGTGCCAATACGACGATTGTATGTCG
TACAACACCAAGCTGTTAAGACAGTTCAAAGACTCCGACGGACAGGTAGCGTGTGGCCCCGTAAGTCAGACGCATTCGCTCTAGAATTTCAAGCAAGACA
GTCGGGATAACCACGTAAATCTACTTTAAAACGTACTGTAACTAGTACGAAGTAGTATCATTCCTTTGATTGATATGTATGACCCAGTTCTTGAGGAGTT
TGACGAATGGAcaagtcgtcgtcctctaCACACATAGAGTCATTGGGATTCAATCTAGCGCCCATGGGGGTGACACGACATGCCTCGGTCCTGCACCGCA
GCGAAACACTTTTCAGCGCCCCAAGCAGAGAAGAACCTTGCATGCGTGCCCTTATAAATTCCTACAGCGCAACATTCAAGTTGATACGATACAATGTATA
GGACTGATCCTAATATCTATAGCGTTGTATCCTCCACGCGTTCAAATTGCAGACTGAAAATGACACGCACATCCGCGCGAACCGGCTCCTGTCCGCCATT
CA