Description :
From Genome Similarity Track
Location :
Scaffold_1:3636379- 3640665
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00986hypothetical protein

Sequence
4286 bases(100 bases per row)
TTTGCCCCCTGTCGTGGGTGACACGAGCGGTACTCAAGGATACGCCCTCCAAATGGGGGAACAATGCCCCCATTGACCACGAAAGGGTTAAATTGAATAG
CAGTGCACTGCCACGGTTCGAAGACTTAAGTAGCGCGACAGCAGACTCATACAGCTCTTTGCTACATGGCAAACTAACAGTAAGTTGTTTCGCTCTCCGG
AGCGTTGTTTTCCCCAAGTGTGGTAGCTTGTACAGGTTGCCTCCTTTTTCTCGTAAAATCTCCTGCATATATGCCTGTAAGTTCAAAACAAATATCATCT
ATTGTGTCAGTCTTCAGCTCCCGAAAAGCGCCCACAAACGACGCTATGAGAGCGATGATACCCTTTCTTGGTATTCGATTCTTAATACTTTGCATGGAGG
CGAACAGACCCAGGGCTAAACAGTTGGGGGGGGGCTGGCACAGTAGCTTGATGTTCCATCCTCCTTCAGTTCCGGCCTTCATTACATCCGGGTCTGTTAG
CGCTACGTGTGGTTTTGCATTGTCTTGTTGTACGAATATGATTTCACGACGATCCTTCCTTGGCCAATTTGATTTGATCGCTGGGAATACTTTCGTCAGA
ATGTATTCCTTGTATACTTCCCGGCAGACTGTATCGATATTACGAGTGCAAATAGTCCCTTTGTCTCTTTTTTTTTGCTTCGCCGCTTCGCCTCGTACTG
TTCCGTGAAAGACCATATCCCAACTTTGCCATCCCAACGCTGCTTTCGGTGAGGATCGTACCTAAAATTAAAAATAAAATGTTAACGGTTTTCATTTTCC
AAAAAACTAAAAATATAGAGGCTTACATTGGCCGTGCAAGTGCAGTTAAAACATCGTCTTTGGAACGATTCGCTTGCTCTTCCATGCACGTGCAGGTAGT
TCTTCGCCGTCGAAAACGAGGTATGAGCGTCTGTTGCGGTCTGCGTAAAACCACTTCTCATCTACATGCACTAGATTGTGCATAGGCTCGAACTGCAAGA
TAGATTTGTCGATAAACGACAACGCGTGCTCTACGTGCCGTATCTTGTTATCATTCGTTAGTGCCGGCTTGATAAACGTGGTTCGTCGCGTTACAATCCC
CTCATTCACTGCCTGTCTTATCAGATGCCTGGAGAGACCGCCGCCACACATCGTTTAACCACTCTATCCTCGATGGGAACACTCTTCAGTTTGTCACGTA
CTTCGTCTCGATTCTTCCGCTTTCTGCCGCTGTTCTTCTTAATCCGGCTAAGCCACTCCCCCCCCCACGACGACACCAGCCGTCACTGCAGAGCTGTACC
GCTTCCAAATTAACCTCACGGTGTCCGAATGTCGGCTCATTAGAACACCAACTTTAGCAAACGCTCCACGGGGTACTTCTCCATTGTTGCTGATCTTTAG
AAGCTCGTCAATGACGGTTTTGCGCTCGGTGTCGGTAAGGTTGGACTTCGGTATGCTTGTAGAGGGAGACGCAGCGTAGCGCAGGCGTGGCGGGTCGCAC
TCCAGGCGAGGCTGGAGACCTTAAGAGTTAGAAATGAAATGGCAGAGGCTACAGTAGTTCGTTCAGCGCAAAACTAGTGGCTAGAAAAAGAGAAGATGCG
GGGCTTTCGTTTTGTCCAATCAGATGCTGTAACTGTTAAATAGAGCTGAAGCAATTGGTAGTCGGTTTCGCGTGATCATTTCCAACCAGAGGAAGTAGAA
GATAGTAGAAACCATACACGATTCATGAGTAAAACTCTTTTTGAAACAATGTTGCTTGTTTCAAACGAGTTTTTACTCATGAATCGTATAAGAAGTATAA
GTTTTTCTATAGGTCGCGTGCCGTCCATGGCGAAACTCTGGATTTGGATTTAAATCCAGAAAATATTGATCGTATTAGTGTTATTTAATACAATGGCGTG
AACAACTCTCACAAAATGTGGTTGATTCATAAATCTGGGTTGAATCGCCCAAACAATTATCAACAGAGGCCGAAGAGAAATTCTTTGAAGTTAGAAACTC
GTTTACTTCAAGACAAATAGAAGAGCAGCAATCTGCGTCATATATCCGTCACGGTTCAACTCCCGACTCGGAGTATTGTGGCACAAGAGAGCTCCGGTCT
GAAGGACCGGTTCTCCTCATTTTCATGCAACAGGATTAGTCGATTAAACAACCTTGCCAGCAAGGGAGTCCAATACGGCGTCAAAAATATACAGGACTGT
CTTTTCGTAGTTCTCGATCACAATTTCGGTGGTCTGCCCAACGGCCTTAGCCGAATCGATGAAGGGATCGCTGCTGTCTGCGAGAGTTGGGGACATTCGA
ACACAAGCACGAAAGATCGTAGCATTCTGAGGGTCTTCCTCTGCTGGCTCGAACACGCACCTATCATTGTTACACAAGCATAACCTGTGAGCTCTCAGCT
AATTAATCCTACTAAAGTTGACGCACCATCCTTTTTGGTGAACACGCATGGAGATATCATCGTGCGAACACAGCCCGTCACACTCCCACACGAATTTCAG
CTTATTCGACTCGTAGTACCTTCGAACTGCGATATTGCCCAAAGATTGCCTGGAACCAGAGGGGTTAGTTACCGTGCAATGCCCAAACATTTCGTTGCCT
TGATTTTGAAGGGCCTGTCACACAGTTGACTAGCGTGAATAGATATAGCAGCCTGAATTACTACCACTTCGTACCATCTGAAAGTCTTTGTGACCGTTTG
AGCTTGATAGAAAGTCCCAGGCTTGATCTCCGATCCTCACGATACTAAAAGGTATCAGTCGGCTCTCCACAAACTGCAGACATATTCGCGGCCCGCAGCC
GCCGGTAGTCTCCATTTCCATATTCATTTTTCTCTTGCCCACAAGACTAGGTGCTGGCATGCTGGGTTGATGCAGCAATAAGTTGCCAACACCACTGCTG
TACGAAGACGAAATATTCCTGAAGAGCTCTCTGTACAGATCCTTCGACGTTGGCGATTCACATCGCGTCGTTCCGTTCAGCGTAGAGCATTCTGATGCAA
TCCCCAATTTCTAAAGTATCCGTTCATCACATCACAATAGGTATTAAGCACCGCAACAGAAAACATGAATCGCCACTATGGCTTACACTTAAATCGGGGG
TCTTATCCAACGCCCGCTGCATTGCCTTGACCGACTTGACCTGCTCCCTTACAAGCTGCCGCAGTCGAGCGTTTTCACCCACAGCCCGTTGTCGCTCGGT
CATGAGCTGGTTAGAAATGTGTTTCCAAGTGTGGTTGACATCTGGTTGTTCCTCGTTCGACGCCCTGTTCAGCATATGAAGTTTCTTCTCAAGCTCCACT
GCCACTGCTCGAAGATGGTCCAGCTCGTGTTTGCGGCGCTTCCGCTTGGGCTTTACACCAGACGGCGCTGGCATCTCTGTACAGGCAGTAGCGCCCACTT
TGCGCTTGCTCTTAGTGGCCAGAGCTGGAAGTGAAGATGCGGAGCTAGTACTTTCAGACTGGCTGCCATCAGAGGCCCTCAGGACTCCCACGTCGTCACC
CGACCCGAACGAATCCATGAAGTCCTCAAAGGCCTGCTCCGACGACAGCACGTCCTCACTCAGCACAACATTGACTGAAGGTCCTGGAGCTTCGTCTCTC
ACGCTATCCGCGTCGATCCCTGTGAGCACGTCCAGAAGCTCCGCCTCCGAGAAGAGTGGCGGGGCAACCATGTTTTGTGGCATTTTTAACTGTTTCTTAA
GAATGCTGGTCAGTTTAATTGCCCCCAATAGCCGATATCGATAATAAGAGGAAGCAACGTTGAAGTGACTGCATTTTCTAATGGTACGCTAGCCCCGTAA
AGATTTTCCAGGCCTTCTTTTTAATATTTTTTCGAAGCTGACAGACACGAGCTTGTTTTATATGACTTGGAGGCACATGTGGAGGTCGTCATTATTATCC
GTCTTAATTTCAGTTCTCACCTTCTTGATTCCATCAAGACGCGGACTTGAGGGTTTACTCTGGCGCTGTTTTACAGTATCGACAGATTATGGAAACGATC
TTAGTACAGTTCACTGCATTGACGAGGAGCATCGGTACTCTCCCCGACTTTTGCGTGTACGTCGTAGAACTCACTGCAGTCTACCGTCATAGTGCGTTGC
GTAGTAGCGAAAGGAGTGGTTGAAACGCCACAAGTATTAATGCTGGAACCCTCTCCAGACAACGCTGTAGTGTTGTAAATACTGTTACTTGTTCGCGAAC
TAGACCCCCAAGCTTAATACCACGAATAATAGGGTAAGAGCGTTCTTCACCGTCGATTTCTGTCTCTCCTCAGCAATCGATTGGAT