Description :
From Genome Similarity Track
Location :
scaffold_436:3636- 9263
Transcript NameFunction/comments
Pl_104871conserved hypothetical protein
Pl_104872hypothetical protein PHYSODRAFT_513613
Pl_104873conserved hypothetical protein
Pl_104874conserved hypothetical protein
Pl_104875ABC transporters ABCA family

Sequence
5627 bases(100 bases per row)
GACATGAACGTGACCATCAAAACACGCGAGATGGAGAGGAGTCTCCAGCGCATCATTGTGGACATCAACGTTCCAACCGAAATCAAGCAGCAGTTGCAAC
ACATCTAGATGACCGCGAGCTGCTGCATGATGCACAGGAGAGTACCCGAGCTATACAAAGTACCAAATTCAGTCAGAAACAGTATGGCAAACACCATTTC
ACCAAGACACGTACGAGGCCTCTGCATCTGTCCCTATCGACACCTTGATGCAACAATAGGAAGACAGCACGTTGTTTCCCTTTCTCACTGGCAATCAATA
GCTGCTCACTCAACTGGTTCGTCGCGATCCGCAAGAGACTCGTTAATTGCTGTGCTGCATCATCTTTCTGTCTCCGCTTGGTCGTCTTCTTACTGAGCTT
CCGACTATGAGTCTTGGGTTGCTCGTGCATCATGCTCAACCTCGACGAATTCTTCCCAGCCGAAGTCGATGGCCGCGCCACATCACCATTTCCATCGATT
GCCATGCCTAGCGATATATAATTTTAACAGCTACGAATTGTTGTTGTAGCAAATATAGTAGCAATAACAACTACAACTACAACTTGCACTTGACCGTCAC
TCTCTCATAGTGATGGTCATTTTAACCGGTCCCAGTGAACCGGACCGTTACCTTCGTGCAACCTGATGCTATGTTGCGCAATGTTGCACGAACGAGACCT
CAGTGTGCGGCTCTGAATCGACTCGACAGACGCTAGCGACCATGGTGAAGCCGGTGGTGAATGCCAACATGAACAAGACCTTCCGCGAGGTGGTGGGCCG
CTTCGTGGGTGCGCCGCAGCAGCTCTCGCACAAGCAGAAGGTGCAGCGTCTGTACAAGCAGTCGCTCAAGACGCTGGACTCGTGGGTCATCGACCGTCGC
CTATGGAACGAGGAGGCCACCAAGATCCGCGCTGAATTTGACGCTAACAGCACGTTGGACCCCGAATCTGGGTATGTTTCGTTTGATGGTGTCAACTTTT
GACATTTCGCTCTCCATGTCATATTTGCCATCGTTCCGGTGGTCTATACTTAGATGGTATTGTTGACGTGGTTTTTGACGGATGTTGATCTCTTATTCAG
ACTTGCCAAGCGTCTGGTGCGCGAGGCACAGGAGAAGGTGGACCACTACACGCACCCGGACCGCTATATATTCAACTACATGCCTGGTGGAAGTCTTTAC
ATGCGTAATGCACCCATCCCGCTGGACGTGTGCTTCCCGGACGGAGAAATCCCTGACGACGTGGAGCTGTCGCCGCTTGAGGCCATCAACATCGACATGA
CGCCACTTCCCGCCAAGGAGACGGTCTTTGTTGACTTCTCCAAGAAGGGCTACGACTAAGCGTCATTAGCAGAGAAGATTCTACTGACAATGGAGAGTGG
AAAATACCATTGCTGACAGGACGTGATCGAAGCAATTACAACGAGAAAATTCATGGCAGAACGGGTAAAGGTGGTGTTTGGTGTGAGTTGTGGGGTATTT
TGATAAGTGCTTTTACAGGTGAATGGATTCACGCTCAGGAGTAGTCAAGCTGGTCACAGATACGGGACTTGGTAACAGCAGTGTTCAGACCGAAGTCACG
GTAGCGGAAACCGTTGAAGGAGTTGGTGAAAGTGTTTGGGCGCCCTTGTCGCTCGACGTCGACCTTGAGCTGAGATTTTTCAGCACCGATTTCTCGATAG
CTTGTGGCGTAGAGAGGATGCTGGCTTTGTGCTTCAGTGATCGCCTTAACGTCGATGGGTTTGGGCATGATTTCCTCGGGGCGGATTGCACAGTCTTCTG
GCGCTGTTACATCGACATGTCGGATAGTCACAAGACCAGAAGCCTCCACCTCTGTCCAGTAGAGTATCACATTAGTGCGAGCGCTCAACATTCGTTTGGG
TCAAGGACGCACCTTTGTGTACTGTAAACTTGTCCATCCGCTGACTCAGTCTCGAGCGTTCCTGTCCCCGAACACCGTCTCCAAGAGCCCCTGATGTCGT
TTGGTACATGAACTCGGTCAACGCATTCGTAGACCGTGGTTGACCAGTTCCAATCTGATTGTTGCTCGAGCTGCCCTGGAGCTTTGAAGTATCAAATGTC
ACTTGTTCATGTAAATCGATACCAACTATCCCAGAGCTCGTGGTCATGAACGGGTTGTTGGTCCGACGCATGTGGTGGATCGAAGAGCCTCGTGATACCA
TGCTTCCTCAACTAGTCCTTGCACAACTTCCTCAAAATCTCAAATGCTTTCCACACCTCTGCAGAAATATCGTTCTAATTCTACATTAGCGGCTCCATTT
CCGGCACAAGTTCTTATCAGAGTAGCTGCCATTGATAGACAAACAAATTCGACGCTCAATGTCGTTCATTGGCAACGATGTAGCCATGTCCAGGTCATGC
CCATGCACATAGGCATGATTGGCCAAAACTTGGTACGAGTTGGCACGATGGTGTCTGTGGGAATGCTGGAGCTATGGCAGCTCACGTGGCTGATAGCGGT
GACTGGCGGGTTGCTCTCGTTTCACAGTAATTTCTGCCGTGGATTCGTCCTGCAGGGCAAGATGCGTACTTCCGTTGCTGTATCGCAACTCCCCGGGCTT
TCATTGCTGCATGTGGAAGTACCCAAAAGCTACTGGACGTGGTTTTACCTCATCGGAGCTCTGCATAGCATCTTTATGCTGGTCGTTGTAGTCTTTTGGC
AAGATACCCAAGTTGTTCAATACGTGCTGCATCTGGCACACCCTTCAATTGATCAAGAAATCAGCATGTTGGTAATTATCCAGCCCCACACTATCGCCTT
CCTGACACTGTTTTCAATACACACAACTCGGCGCTTCCTCGAATCACTCTTTGTTACAGCGTTTGGTGATGCCAGAATGCACGCATGCAGTAAGTTTTCA
TCTTTTCTTTTCTTTTCTTTTCTTTTCGATGAGCGATGTGCCATTGACGTTGGTTGGTTGTGTGGCTTTAGTTTTGTTCGTAGGCACATATCACTACGTT
GCTACAGTGCTATCTGTGCTCTTCGATCCGGACTCTGTTATGGTGCACAAGCTCACAACAACACGTTGGTTGATGGCTGGGTTGGGTGTTGCGATCTTCG
TCATTGCATCTTACCATCAAACACGCTGTAACTATCTACTAGCGAAGCAAAAGCGCGCTAACAACATGAAACACGTGATTCCTCGTGGTGACTGGTTCGA
GACTGTGCGCAGTCCACTCTACACAACTGAAATCATGCTTTACGCAGGCTTCATTTTGGTCACTGGAGGGACAACCGTCATGCTCTACCTCGTGACTCTC
TGGGTAATTGTCAACCAAGTTCTACTCGCTCAAATCAGCTCACAGTGGATCGAGGAGAAGTTCCGAGACCAAATCAAAGAACTCCCCAAGTGGAAGTTGC
TCCCGTACGTTTGGTGAACAAAACAATCAATTTTGTGAAGAAGTGTCACTGAAATCTATTTGGAAACTTCGTACGTTCATGCTCCGTCGAGTTGCTTCTT
GTGGCAATTGTCTCCCCTTCACTTGTCTGCCTTCTGCTTCTTCAGAGGTGCTTCCGACTCTTTAGTCTCCTCTTCACTGTCACTCGCTCCACTCTCACTT
TCACTCTCACTCTCACTCTCACTCTCACTCTCACTCTCCTTAATTGGTTCGCCTCTCTTCCTCTTCTTCTCTTCAGTATCACTCTCATCCTCTTCTTCCT
CCTGCTCAGTAGCCCAGACCTGTTTCATCTCTCCCTTCTTCTCTCTGGCGATCTGAATCCTGGCCAAGTACTGTCCGTACTTATTTCCAAAGATGTTTTG
GTACCCTCCAGGTCCTGAAGCACAACCTCTACATCCACTGTGTTTCTCCTGCACCACTTGTCCCTCCGAGAGCTGCTGTCTCGGAACACGACAGATACTG
ACGGTTCCGTAGTTGTAGTTCTTCGTGTTGATAGCGAACGTGCTGCACAGTCGTTCGTAGCCCGGTTTCTTCCACTTGGCAATGAGATTGGCGTCCACCA
ATTTGCGTCGTACACAATAGTCGTACACGTCTCGCGAGATCTTCTTGTACTTGTAGAACATGTCGTACACGTAGCGACTGCGCTGCCAGTTGATCTGGTG
CACAGGCCACAGCGCCTCACACTGTCGCTTGCCCTCGTGTGGCTCGTTCATTTTCTCGCGTAGTTCACTCTCCAGTGCGTCCATCACGGGCTGAATGTAC
TCGTAGCCCGCAGGCGCACGGTTCTTCTTGCTCCATTTCGCCATGATGCCTCAAATTGATTAATGGTTAGTGCTAGTCTAGAAAAAGAATTTATGTGGCT
AATTTACGAGTTATAGACTATTGACTTACAAATAGGTAGATCCTTATTTTGCCATGAATGAATAATTACGAAAGTAGACATGTATCGTTGTGAAAATGTA
CTTTTGCTTATAGGTTAGTTTTACGCGATATTCATGCCATGTGCGACTCCCTTCTCCTCGTCCTGTTGAGCTGCCATGTTGTTAAAAATGTGTTCCAGTG
CAGTTTCACTCACGCTGTACTCGTCCACGTTCAAGTTGGTACGAGTTTGTTCGAGTGCACGGAAAATCTCAGCTGGACGCAGCACTGCCTCGCTTTCAGG
TCGATGCTTGGGAACTTGGAAACGGAAGTGTTCACCCTGTTGTTCCGCGAGGACACTGCCAGGAAACTTGTCGTGGAAAAAGTTCTGCAGCGTCTCGCCG
TGGGTTTCGGAGACCCACCACGAGCAGAAAGTGTCGACAGAGATCGAACCTTGGGCCTCAAGCTGACTGCTGAGCAGCCACCCAGTACCTGAATGATCAA
GGATGCGAGCGCCGCGTTCAGGAGCTCCAAGAACAGTGCACAGGTCTTGGATGTTTGCAGATGTGACATTCCCCGCATTGTTCCCTTGGAAACTGCTCGA
GCTCTGGCGTTGACTGGTTCTGCTGCTACGTCGCGCCGACAGACTCCGTTCAGCTGCGAGGAATGCTCGCACCTGGCCTGTAACACTTGCCAGCTCCGTT
GCGTCAGAACCCGGCGAACTAGTCAAGGCACGAAGCGTGATGTCTACGGTGTAACCTCGGCCGAACTTCTGCTTGAGATGCTCGACACTGCCAAGACATT
TTAACCGACCACTGACGAGGATGCCCACTCGAGAGCAAAGGGCCTCGCACTCCTCCATACTATGTGTAGTAAGGACCACACACGCCCCACCGTCACGATT
ACCCTCCGTTGAACACACGCGTGCGATGACATCCCACATCTTTCGTCGAGAGCTTGGATCCACACCTGTCGAGGGCTCATCGAGGAATACGACGCGAGGA
CGTCCGAGAAGTGCGATGGCCGTCGAAACCTTGCGCTTATTGCCGCCGCTAAGCCCTTGGGTAAGCTTATCACGGTACTTAGTTAGACCCAGTTCTTGAA
TCTGTTCGTCCACTGCAGTATTCACGAAAGACTCCGGAATGCCCTTAATCCGAGCGTACAGCTGTAGCTGCTCCTTCACCGTTAGCAGGTCGTGTAAAGC
GTCAAACTGTGGACAGTAGCCCATCGTCTTTCGTGCGGAAGCCGAACTGGTTGATAAATCAAACCCGCTAAGTGTGACGAAGCCGTCAGTGGGCGCCAAC
TGGCCCGTCAGGACAGCCATGGTCGTC