Description :
From Genome Similarity Track
Location :
scaffold_436:3636- 5949
Transcript NameFunction/comments
Pl_104871conserved hypothetical protein
Pl_104872hypothetical protein PHYSODRAFT_513613

Sequence
2313 bases(100 bases per row)
GACATGAACGTGACCATCAAAACACGCGAGATGGAGAGGAGTCTCCAGCGCATCATTGTGGACATCAACGTTCCAACCGAAATCAAGCAGCAGTTGCAAC
ACATCTAGATGACCGCGAGCTGCTGCATGATGCACAGGAGAGTACCCGAGCTATACAAAGTACCAAATTCAGTCAGAAACAGTATGGCAAACACCATTTC
ACCAAGACACGTACGAGGCCTCTGCATCTGTCCCTATCGACACCTTGATGCAACAATAGGAAGACAGCACGTTGTTTCCCTTTCTCACTGGCAATCAATA
GCTGCTCACTCAACTGGTTCGTCGCGATCCGCAAGAGACTCGTTAATTGCTGTGCTGCATCATCTTTCTGTCTCCGCTTGGTCGTCTTCTTACTGAGCTT
CCGACTATGAGTCTTGGGTTGCTCGTGCATCATGCTCAACCTCGACGAATTCTTCCCAGCCGAAGTCGATGGCCGCGCCACATCACCATTTCCATCGATT
GCCATGCCTAGCGATATATAATTTTAACAGCTACGAATTGTTGTTGTAGCAAATATAGTAGCAATAACAACTACAACTACAACTTGCACTTGACCGTCAC
TCTCTCATAGTGATGGTCATTTTAACCGGTCCCAGTGAACCGGACCGTTACCTTCGTGCAACCTGATGCTATGTTGCGCAATGTTGCACGAACGAGACCT
CAGTGTGCGGCTCTGAATCGACTCGACAGACGCTAGCGACCATGGTGAAGCCGGTGGTGAATGCCAACATGAACAAGACCTTCCGCGAGGTGGTGGGCCG
CTTCGTGGGTGCGCCGCAGCAGCTCTCGCACAAGCAGAAGGTGCAGCGTCTGTACAAGCAGTCGCTCAAGACGCTGGACTCGTGGGTCATCGACCGTCGC
CTATGGAACGAGGAGGCCACCAAGATCCGCGCTGAATTTGACGCTAACAGCACGTTGGACCCCGAATCTGGGTATGTTTCGTTTGATGGTGTCAACTTTT
GACATTTCGCTCTCCATGTCATATTTGCCATCGTTCCGGTGGTCTATACTTAGATGGTATTGTTGACGTGGTTTTTGACGGATGTTGATCTCTTATTCAG
ACTTGCCAAGCGTCTGGTGCGCGAGGCACAGGAGAAGGTGGACCACTACACGCACCCGGACCGCTATATATTCAACTACATGCCTGGTGGAAGTCTTTAC
ATGCGTAATGCACCCATCCCGCTGGACGTGTGCTTCCCGGACGGAGAAATCCCTGACGACGTGGAGCTGTCGCCGCTTGAGGCCATCAACATCGACATGA
CGCCACTTCCCGCCAAGGAGACGGTCTTTGTTGACTTCTCCAAGAAGGGCTACGACTAAGCGTCATTAGCAGAGAAGATTCTACTGACAATGGAGAGTGG
AAAATACCATTGCTGACAGGACGTGATCGAAGCAATTACAACGAGAAAATTCATGGCAGAACGGGTAAAGGTGGTGTTTGGTGTGAGTTGTGGGGTATTT
TGATAAGTGCTTTTACAGGTGAATGGATTCACGCTCAGGAGTAGTCAAGCTGGTCACAGATACGGGACTTGGTAACAGCAGTGTTCAGACCGAAGTCACG
GTAGCGGAAACCGTTGAAGGAGTTGGTGAAAGTGTTTGGGCGCCCTTGTCGCTCGACGTCGACCTTGAGCTGAGATTTTTCAGCACCGATTTCTCGATAG
CTTGTGGCGTAGAGAGGATGCTGGCTTTGTGCTTCAGTGATCGCCTTAACGTCGATGGGTTTGGGCATGATTTCCTCGGGGCGGATTGCACAGTCTTCTG
GCGCTGTTACATCGACATGTCGGATAGTCACAAGACCAGAAGCCTCCACCTCTGTCCAGTAGAGTATCACATTAGTGCGAGCGCTCAACATTCGTTTGGG
TCAAGGACGCACCTTTGTGTACTGTAAACTTGTCCATCCGCTGACTCAGTCTCGAGCGTTCCTGTCCCCGAACACCGTCTCCAAGAGCCCCTGATGTCGT
TTGGTACATGAACTCGGTCAACGCATTCGTAGACCGTGGTTGACCAGTTCCAATCTGATTGTTGCTCGAGCTGCCCTGGAGCTTTGAAGTATCAAATGTC
ACTTGTTCATGTAAATCGATACCAACTATCCCAGAGCTCGTGGTCATGAACGGGTTGTTGGTCCGACGCATGTGGTGGATCGAAGAGCCTCGTGATACCA
TGCTTCCTCAACTAGTCCTTGCACAACTTCCTCAAAATCTCAAATGCTTTCCACACCTCTGCAGAAATATCGTTCTAATTCTACATTAGCGGCTCCATTT
CCGGCACAAGTTC