Description :
From Genome Similarity Track
Location :
Scaffold_12:36355- 40928
Transcript NameFunction/comments
Phyke_g2271conserved hypothetical protein

Sequence
4573 bases(100 bases per row)
CAATGGGCCAGGCAGGCTCcttgcagcagaagagcgCACTGCGTGATGTCCTCTCATTGCGACGGGGCGTCAGCAACACCGAGCTCGAGGAGGTTTTGCG
TACGTTTTGTGCCTTATTCCCACTCGAGGTaaagtaaaaaaaagaagcTATAAACTTTAGTTTACTTATTACTTAAGTATTTACCATAATAATATCTCTG
TACTGTAGTTACCAGTGACTGTCGATGCAAGTCTGGCCAGCAGTGTTACAGGCGTGGACATCAAGGAGCGTCGACTCTTCGATGTGGTGCATTCGTTGCT
ACAAGACCAGACAGAGCAAGCTCAGCGTAATGCTAAAAATCGGGATATGACAGAGCTCGTTCTCACCAGTTTCCGCCGGATTATTCGCTGGAGAAACCTC
TATAAACTCTGTGCCAAGTGCTCCATGAAGCCATTCATCACGTGTCTCTACCGGCCGTCGCCCAGACTCGTGCTCTCAGTGCTGGTGACGttggagctga
tgctgtcgCCCTGTCCAGGGTTTGAGTCTGGAGACAAGGCGGCGGAAAGAAGCGAGGCGGCCAACCGCCGGAATTTTGGTGATGCAGGAGGCTACGAGGT
TTTACGCTCGCTGCTGACGCAGTACGGAGCTCTagtggtgaaggaggagcaTGGAGATGCAGCGGCTGTATTGACGGGGGTCTTAAAGTTGTTTTGTTTG
ACGTTGGTGTCGCGTCGAGTGGCGACAGATTTATTGACGTGTTCACAAGCTGTGGACGCACTTATGAATGCGCGTGTGTCACTGTTGGATTTGTGTCATT
GTCGTGACAAAGAGTATGACGTGATGCGTCTAGCCTCGGAGTTGGTGAAGGAACTTTTTTCTATCGTTACTATTGAGCAAGTGCATGAGTTACAGGAAGC
AGCGAGAGAGTATGGAGCATTGTTGTATGCTctggcaacagcagtgcaagAGGAGAAGGAATTGGAGACGTCACAGAATGGTGAAaaggtggtggaagaa
tACTATGGAAGCGGTGAAATTGATCACGATATGCGAGAGATATCCGTGGACCTTGTCGAGTTGTTTTGCGCCGGCAATATGCGCTCCAAGAAGACTATGC
ACCGCATTTTCCCGGTGGAGGTATTCGTCCCTAAAGATGCCCATTCCGATCGAATTGTGCAGCACACAACGGCATCACCTTCCTCTCTGTATCATACTAA
ACCCATACCTGGTGCGAATAGTGCACGGACACTACCACATTTCTCGATTGACTTTGAGCCACACAGACGGACATCTATAGCGACGTCGAATGCTTCTTCT
ACAACTGGAAATATTGAAATCAAGCGCAATCGTATGGTAGCACTCGCGTATAACGCGATAAACCTTGGTGGAGGAGTTTTCGAGCGGTGGCTTGACGATG
CGCGTGAGAAAGGTGAGCTTTGGAGGGAAATAATTGAAGCCGCCCGGCGCACACATGAAACCCCAGAACTCGTTTGGCGTGCTGCCATGCGCGCGGAATT
ATATCAGGCGCTACGTACAGAGATCAATGCACTTgaacgacgaagacgctgtcTGGTGGATGATAAGGCTGCAGAGACTGGAGGACATCTTGCGCGCTGG
GATCATGAGATGTTTTATGTGGAGTACCCGTCAATGCAAGCAGAACTCATCGTAAACGGTTACTTTGTGGAGTATCTGATCCCTCGCGTGGCTGACCTGA
CTGAGTCGTATGAGATCGCCGAGCCTGTGGTTTTAGCATGGCACCTTTCCGATCAACTTGCGGTGGAAAACGACGAGAAGTGGGCGATACTTTGTGTGCG
ATGTCTACGCTTAATTATCAGGCGGTACGCAATGTTGTTTCACGGCCAACTCCCGACCTTGCAAGTTCTACGGTCGCTGCATGACCACGTAAACCACCCT
CCGGCATTCGTGCGCGAGTGCTTTCTTCTACTTAGCGCTGCTATTGTTACAACGCGCAATACACCATCAGTATGCATCAATCAACTCTGCATCAGTGTCA
CGCGCACTGTTGTGGACGTGCTTGCGGATCCAGTACTGTTAGCTACGCTGTCGTCACTAGTGGACTCTCAAaacgacgaagaggacgaaggCATTTTACA
TTTAACTGACCCTGAGGATGATACGATTTCTGTGGTCAATGATCGTGATGCATTAATACGGGCTGGTATTTCATTGTTGCTCGCGATTGTTCGGCGCGCT
AAGTTCGTCTTACGATTGATTCGACCCAAGCGCGTGTTCATGTGTCGCCTTCTTGCGGTAGAAACTTTGGATCACGTGACTATTACCCGACTGCTTTTTG
TGCTAAAGCAATTAGCACTTCAAGACAACAGCTGCGACATCAGTATCGGCGTCAGCTCAAGTGGAAGCAATTGCTCTTTACTCCTCCAGTCATCGTCAAT
GTCGTCTCAGGCGAACGCATCAAAGGATAGCAACTGGAGATCTCTAACACTGGTGTATGTTCTACTAGCTAGCTGTGACCCGAAAGGCATGGGCATGtgt
gtggctgctgctgagtttCTGAAGGAAACTTCTGAGCTGTCGTCGCTCGCACATCAAGTTGGCGGAGTGAGCAGTCCAGGCTTGTTCAGCGAGCTGAACG
ACTTGCTAAATGATGCGCTTGGGTTTGGTGGTTGTGGAATGGGGAGGTTGTTGAATTCTGTAAGTGCGGAGGTCTTTGCCAGTACGTTCAACGCATCTCA
AAAGCGCGCGGCAGATGTAAATTGGGGTCGGAAGCAGCGCGTACGGTTGTACCGTTATTTGAAGCACAAGTATGTTGGCTCTAGCGACAaatcaacttct
tcatccgaaTGGAACAGTTTTGGCGACGACAACGCTGATGATCACCAGTACGAGGACGACGATCTATTTATTGGCAATATCTTCCTACGATCTTACATTG
AGGGCGAAGGAGAATTTTTGAACAACTGGACGCCCAAAATGTATAGTGAACTAATTAACGCgctgttcgaggagctggTGTTGCTTGGTCGCAGAAAATC
TACGTACACTGGAAATGGAAGTGTCGGCCCATTGCCCTCGCCACCATCGCAGCCATCCTCGACCCTATCTTCTATAAGCAGTGCTGCCGAACCATGGGAG
GTGCAGGTGCTTATCCTGAAGGCATTGGCTCGGCTTGTACCATCACACTGTGCTGAAGTGGAGATCAAAACTGAGTTTTACGAATCTCTGTTGGCTCCTC
TTCGCCGCTCGATGCTTAGTGAGGTCGATCAAGTACGCGGGATCTTGTCGTTGGAACTTTTTGTGACTGTGCTATCCGTTCCTGAAAAGCGCAGCGTTAA
TACGGCAGCATGCCGTCTGTTCCTTGAAGAAAAAGGCTTGAGTACTTTGGCCGACGCTCTAGTGCGTATGCGCAGCCCAGCGTTTCAACAGGTTCTATCA
ACTGTGGCGTTATTGGGTCCCCCTCGACGGGGTAGCCATACTCAGAATATGGCGCGCATGCTGCTCTGTCGATCAACCGAGTTGCTGTCCATTTTATCCA
AACAGCAGGTTGCAGGCATTCGTGCAATTACAAAGAATCATGGAGTTATCACTGCATTGATCGAGCTTACATCACGCCAGATGATCATGCAATACGCAGA
TatcgatgcagcaacagcttgttTAAGCTGCCTGGGCGGATTATGCCACTACGATGAGCTTCGAATGCAAGtggtcgctgctggtggattgCTGTCGCTT
TTAGATACTGTTGCTTTTTGTCCGGCAGAAGAACTTGATGACACGGCTCCAGCTGCCCAGGttggcagtgatgatgaaacGAAGGAGGAAAATcaaaaca
gcagcacttcGGTTGAGAAAAACAgtagtgacgacgacgtgaACAGCAAAATCGACATGGTTGAAGAGGTTCAGCGGAAACCCTCGCGCTTCTTTGGTGC
AATTCGGAGCGCCGCGTTGGTATTGCGCGCGTGCCTTAGCGCTAAGAGTGCTATAGTGCCATCGTTGGCAActcaagtgcttcagcagctactgACACCA
AGCTTTGTTCGGGTATGCAGAAGGAAAATTGCGGAGGTTGGACAAGGAGGCTAACCAAATTATCTGTTCGTATTGTGCTGCTTTCTTGCGTAGGTATTAC
GTGGATCTCCTGACCAGTTTattcttgagctgcaaaCCACCGAAGATATTAGCACGGCAACATTGATCTGGACCATCGACATGCGGCGACGACTGCAGAA
TTGTATCACGCATGAGCTCACTAAGGTGAaagccgcagctgctgcgaaTTCCTGGCCGCGCTGGGACCCTGAGCACCTTGTAGCCGCTGATTCGTTCAGG
TATCAATACCCAGAACTCGCAGATGTGCTCGTACTGCACGATGTCTATCTGGCCAACTTTGTGGCAACTCCGGTTAAGGATTTGGACCTGGGCGACATCG
ACATGGCTTCCTTCTCAGAGGCGCTTCTAATTTCCATCCAAAGCCACGAAAATGTGCTCCGTATTTTGTACGAGCGAGGAACGAGTGACTCCTCcaaaga
agctgctgtgcAGCTGATGCGACAGGCCATGGAGAAGCTCGTGAGTACTCACCCACAGCACAATCTCGAAGTG