Description :
From Genome Similarity Track
Location :
Scaffold_2:363426- 365167
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001043Similar to vps13D: Putative vacuolar protein sorting-associated protein 13D (Dictyostelium discoideum)

Sequence
1741 bases(100 bases per row)
ATTCGACACGAAAACTCCGCACGCTTTCCAAACGTCCGCATTATTATGGCAACTTGGTGTTGAACACTTCGACCGTCTTCTTGAGCGCCTCCGCAAGCGG
CGCGACGACGAAGTCAGGCGTGTCCCGGCAGCCGACTTCCAGTCTCGAGGCTGCTGTGGGCACGAAGAACCGCGTGCCGCGCGAGTGGCGCAGTCCCTTT
CCGGCTGCGTGCGCCAACGACGATTGCCACATCTCAAAGTCCTGGCGGTTCGCAGCGAGCAGCACGATCTCCGACTGCACGCGCTCGACGACCTGGCCAT
TGTCCATCTGCAGCGTCACGAGCGGCTGGTTCCGGAACGCGTTCGTAATGCGGATGCTCAGTGTCGTGGCGCTCGAATCGGCCTCGAGACGCACGTTGCC
CAGAGGGATGATGCCACGCAGCTCCTTGCGACTCGAAAAGTAGTACAGACAATTGCGACTAAGCACGAACCAGCGCTTGACGGTCGTGAACCCACCTTTT
TTCATCAAAAAGCCATTGAGACTTGTATCCGACGGCCACAACTCCTGCTCTTCCGCTGTCGCCGAGCCAAAGCTGTGCCACATCACGTCCAAAAACACGT
TCATGTCACGCTCATGGCCGTCAAGTGCTCGCAACGACGGCCGCAGACGAGGACCTGTCGGCAAACTGTCCACCCCGACGCTCAGGTGCAGACAAATGCG
GGAGCCTCGCATCCACTCCACGCGGTAGATGTACCGCAATGGCGTCATCCACTCCACAATCGGGTTCGCAAACGAACTCACGTTGATGTACAGCGCACGC
TGCTCTGTGACGATCAGCCAGTGGGTCAGCTGTACTTTCAAACGTGCTCCCTGGTCTGTGTCAGCGACACCTGCACTCGTCGGTGACGCTTGTGCAAGCA
CACTATTTTCTCCTGTGCTGCCTTCTTGCGTCCCGTTACCTTCATTAACCTGTTCATCGCAGCTCTCGAATTGCAGTTTGATCGGACGCGCAGTCCCTCG
CAGCAACGCCAACGTCTCGTCAAAGCCAATGCCACGGACATCCACGCCTCCGACCGTCACCAAGCAATCTCCTTCCTGAAGCACGCGCTGATCGGGACGA
AGCGCAGTGTGTACTTTCGTGTGATGGCGACTGTTTTCGTCAAACGCCTTCACCGTCACATTCTCGCAGTAGAAATCTGTCTCCAAATCCAACCCCAGCT
TCTTCTGATAGAATGTCACCTCGTAGACGAGCTTTCGGCCACGGCCATTCAGCCCGTCGTTTATCTGCTTCACCTCGTTCTCATTCAGACTTCGTCGGAA
CGATTTCGTTCGGTCTTTTGTCGTGTCGCTCTTCTGCCGTTTCTCGCGTGCTTGTTTCGTGAGCTCCGATGCCAGTACCGATTGGATGATCTCGTTATAG
AAGATGATCTTTTCCCCCGACAGCTTGAGGCCACCAACCTTCTTCAGCAAGTCATATGCGATCGTATCGGCCTCTTTGTAGCATTTCAGCTCGTTGTAGC
GCCCAAATACACGAGGCCGTCGCACGCGACGCATGTTTTGACCGTTTTGAAGGGACCGGTTCCGCACACCTTGAGTTGCTCGCGACGCGAAGTCGAAGAT
ACCAGCAACAGGCTTCACGGGCAGACCGATGATGCCTGTAATCGTTCCCTTGACAAATCCGAAGGCACCGTTTTCCTGCGCACCGCGCATTGGCCCCAAG
ACAAGGCCCGCAACACCTTCGTAAACGCCCAGACTAAGCTC