Description :
From Genome Similarity Track
Location :
Scaffold_127:3633- 11329
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-fgenesh-gene-0.1ATP-dependent protease hslV
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.28CAMP-dependent protein kinase regulatory subunit
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.20RRNA-processing protein EFG1
Pytap_DAOMBR444snap-pag1_scaffold_127-abinit-gene-0.115Protein kinase
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.30Protein kinase

Sequence
7696 bases(100 bases per row)
AAGATGCTCGCGCGCTCGCTCCTGCAGTCCTCGCTGCGCTCTGCCGCCGCTGCCTCCAAGGCGTCGAAGTtCCCTGCTTCAGCCATTGCGAACCaTGCTG
TTGCTCGTTTCAGCAGCGCCCCTGAGGTGCCGTGTGCTCTTGTTTaTTGTTGATGTCGTCAAGTGCTGACCTCGATGCTGCAGATGCACGGCACGACGAT
CCTGTGCGTGCGTAAGGAAGGCAAAGTGGTAAGTCTGGgCACtcGTGTGACctGTAATCATACAGGCGATTAACCTGTagTCTTGCAGTGTGTGATCGGT
GATGGaCAGGTGTCACTCGGCCACACTGTGGTCAAGCCAAACGCCAAGAAGGTTCGCCGCATTAACGAGAACATTGTTGCGGGCTTTGCTGGCTCCACCG
CGGACGCGTACACCCTTATGGAaCGCCTTGAAAGCAAGCTTGAGGAGTACCCAGGCCAACTCACCCGCGCCTGTGTTGAACTCGCGAAGGCCTGGCGAAC
AGACAAGTACCTTCGCCGTCTCGAGGTGCGTTTGACACTCGGAGCGATCCCCACAATGCCtttcACTGACGATAGTCTCTGTGAAAGGCGATCCTCATCG
TGTCGGACAGCAAGCAGTCCTACACGCTCACGGGCAACGGTGATGTCGTGGAGCCACACGACGGCATCATCGGTATTGGCTCTGGCGGCACGTACGCCCT
GGGTGAGTCACTGAGTTAGCAAGATGTGTGTGAACTTCAAGCTCACGCGATTTCCATGATACGTAGCTGCTGCTCGTGCGCTTATTGACCAGCCAAACCT
CGACGCAGAGGAGATTGGACGCAAAGCCATGCAGATCGCGGCGGACATCTGTGTCTACACGAACCACAACTTCGTCGTTGAGATCCTCGAAGACAAGACT
GAAAAGAAGGACTAGATTAACGTCTACGTAGCTGATTAGGCGCGCATGTATGCGAAGTAATTCAGAACACGTAGCTGAATGCCACTTGTCGGCACATGTG
CGGAGCTCATGGCTCAAGCGAAGGGATGGATAGATCGTTTGCTATTTCATACAGGTTCAAGGGATGGAAGCGAAAAATCCTCTCAACTTGTGTGCGATCT
CAAACAGCGATCAACACGACTGCCCATCGATCTACCGCTGCTCCCTTGTCGAATAAAAAaTGCTCGAGCTCTTCGACATACTCCAAACCGTGACGCTAGA
TGTTATTGGCGATGACCGAGTTGTACTTGTCGATGTTTCGCTTAaGAATGTCCTCTAATGGACCCATGACGCGCTTGAACGTCTTCCGGTCAAGCGTCAG
ACACTTCACTTTGCCCTTCGCCGTGACGGTCGCTTGaCGCGGTCGGGTCGTCAGCAAGGCGATCTCGCCGAAGTAAGCGCCAGAGGTGAGGTCGCCCATG
ATCACAGGGGGCTCGCCTGGGCTCAGTTGCTTCGTGCACTCGGCCGTGCCCTCCTCAATAATGTAGAACATGTTGCCTTCATCACCTTGTGTGATAATAA
CTTCTCCGTCCGCAAAGGTCTCCGTCTTGAGGGCGTCTGCGACAGTGAGTCGCTCGTACTCGCTCAGCGACTCGAGCAGTGGCACGCGCTCGATAAAGCC
TTTATGAGCCTCACGTTTCTTCAGCGTTGTCTCCATGATGATGTATTTGAACGTTTGGCGGTCCAGTGCCCAGACTTTCGACTTTTCGACGGCTTTTACA
GTTGCGGCACGCGGCGCGTTGTACATCAGTGCGAGTTCACCAAACGACATGGAAGTTGTGCACTGTAGGCCACACTCgCACCccGTCAGCCATGTCAAGC
AAGAAGCATGGCTCCATCACGCACCGTTTGCACGAGGATCTCATCTTTGTAGACTTCGCAGACACCGCTCTCAAGAATgTAGAAGTTGTCGCCGTCGTCG
CCCTGCTTGATGATGATGTCACCAGGCTCGAACTCCTTGGGGAACATGGCGTCGAGCACGATCTGATGCTGCTTCTCGTCCAGCGACTTGAACAGAATGT
TCTCGGCCACCATGCGCGTGATGCGGTCGCGTTCCTCCGTCGACTTGGGGTGGATCACACGCTCGAACTGCTTTGCGCTACATGGAAGAGAGCCAGTAAG
TGTGCCTGTTCAGTCTAAATGGCGTTAGTCCAGAGGTCTAACCTGGATGGGTCGATGGTCTCCGCGGATACCGACGTTCTTCGACCCTTGACCACGGGCT
TTGGAGGCTCGGGCTTCTCGCGGATCTCACCAACGGCATCGTCGTCTTCGTCTTCGCTCTCGGACTCGTCTGAATGGTGGTCTATTGGGCAAAACAGCAc
GCGCGTCAGCAGCGAGCCATCGAGCAGAGTGATCCTAAGCAAACGGACTTGTGTGCGGATGTGGCGCGTGTCCATTGGACGCCGGGTCAACCTCCTTCGA
TGGCGCGGAGAACGACTTCTTCTTGGGAAGGGCCTGCTCGGGGTAGTTTGACTGCAGGTACTGGATGATGTGGCTGATCGGGTTCTCCGGTTTCGAAAGC
AGCAATGACTCGACGAGGTTGATGAACAGGGTGTTAATGCCCTTCTTCTGCAGATAGTCCTGCAGCTCTTGCTGCACTCCTTCGGCGTCAGTCATGGTGG
TCTATCGGTCTAACCGCGACTGTGGGAGTATGAATGCCAGATCGCCAGGCGTTGCGATGGCGTTTctCTCGTTTCCTCTATAGAGTAGTGCTCTTCTCCT
CCCTCTTCGCTGTCGTGcACCGcTCTGCGCGGTGGCTGGTCgATGGAAAaCAaGGaTCGTCGATAGTCAGGCAGTTGtGCGCACGCGATCGATCAACCTC
GCGCCCCAACGACTCGCGACCCGCGTCGTTACAAAaGGaTTTTCGTtGGTTtGGTTCTTTCGTTTTtCGTTTTtCCTTTCGATgtCGTTTCCGTGTTTAT
ATTTCCGGACACAAAACCGTAACGCACCTCGTAAACTTCATGTGCTTTCATGAACGATAGCAACATTTTAATGATTCACGATGTACCGTACAAAGTTGAA
CCTTTGACAGAATGATATTTTTGATTCGAGAGCATTCTACATTATAAAATTACCGAGGATCCAAAGATAGCGTCTCTATCTTCGCCGCAAGTGGAAAGAA
ATCTCTCTCCAGCCAGAACGgTACAGTGAGTTACCCAAaTACAAGCAGgCAGAGCGATTTTTAATGTAGACCACGCTACTTAACGCCAAAGCCCACCAGC
CAATCCAGCAACAGCAACTTCTTGGCGTGAAAAGCAACAGACCtGAAGCACTCCGACCGCCATGGCGCCGACTGCTGGTGCGTGGCGACGCCTctGGGCT
GCGTGTGCGCGTATGAGAGTGTTCTGATGGGTCTGTGGTCGGAATAGGAACCCGTCTTCGCTTCAAGAAGGCGACTGCGAAGAAGCCATTTCAGAAGCAG
AAGAAAGTGCCGTCGCTCAAAAACCGTaTTCGAGCCCTCGAGCGCTTCCTCAAGCGTGGTGGTGTACGTGCACTATGCTGAAGGCTGCGTATGTCGAAGG
TATTGAAGTGTATGTTCCGTTCTTCATGTAGAACATCGATGAGTCGACGCGCAAGGCCAAGACACAcgAGCTTGAGCAGCTGCAGCATGAGGTATGTGGA
GCATCTCACTCTCCGTAGTGCGGTAGACCTGACAATGCGACCTTTGATCACCAGCGAGACGAGAAGGAACGCGTGGAGCTTGAGAAGAGAACGCAGAGAA
GTACAAGAAGGTGGGCTCCTGTTGTCATGGGCAGAGGGTTGAGATGTATCGAATGCTGATGTCTcACTGACGTGGCAGCCGCGATTCTTTGAACGAGTCA
AGCTCATGCGGAAGCTGAAGAAGGCTCAGAGCCATGTCGATGAGGTGGGAATGACTGTGTTTGCTTCcGGGTGCGTTTGTGTATTGCTTTGCTCACAAAT
TCACTTTATAAGGCTACCGACAAGTCAGAGAAGCGCAAGGCAGAGAAGGAGCTTGAGAACGTCCGTCAAGATCTCATGTACATCTATTACTATCCCAAGA
CCGAGCAGTACTTGTCGTTGTTCCCGGCGAaACCTCACTCTGATGAAGCGATGGCTCGTCAgAAGGAGCTTCGCGATGCGGCAATCCAGCGATTCGAGGA
TGAGCAGCCCCacGACGCATTCCACAAGTTCTGCTACGCTGATGGGAAGGATGCCCCAGCAAAGTCAGCGgTGTCACTGCTGGTGAAAAAACCAACAAaG
GAAGAGGAGAAGAAGAAGAAGAAGCCAAAGAAGAGCAAGGACACCGAAGAAGGGAGGTCGGCCAAGAAGGCGAAgAAGGGGGAGCGTGTGCTCGTGGATG
AAGACGAGATCGTCGACGTTCCAGAGAGTGAAGGTACTGGCGGGGATAACGATGAAGACGAAGATGACTTcTtCTTGTgaCATcTCCCCGTCTGCGAGCT
CCGGTGCGCATGTTAATATAATTCAATTCCAATAGATCAAAGGCATTGTAGAGGATCCACCAAAGCTCGAATCATCTGGATGTTgCGAAGTTGCATCTCT
GAGGCAATCAGCTGCGCGACCAGGACTTGATAaTTAATCACTCAAACGACTTGACAAAAATGCACAGTGATAAACGCGAAGCTGaTTTGCTTCGCTTCGG
ATgAaCTTCAAGTGGAGTCTTGACGAATAAGACTCTCTTAAATCAAGATGGAGAgaGAtGATGAGTTCTCTACCTCACTTAGCCTCGTGTCTGCAATCAT
CTCGGCCTCGTTTCGTGACGCAGCTGCTAGAGCATTCATGTTGGTGAAGCTGAAGGACTTGAAGGCTTCAGTCATCTCAGAGTCGTCACGTGCCCCCGTG
TACATTCCACTGGGAAACTTCAGGTTGTTTTCTGTCACAGCTTGCCTCTGAGCGCTGTGGATTCCACTTTGCAGTGTAAAACTCGGCTCAGTAGAAGCAA
AACTTGGGTCCTGCTCTGTCTTCGACCCACTGTCGATGAAAAGCTTGCCGCTTGcGGCACCATCTCCTGTGTCACTGGGACTATTGGTGAATGCGCTCAG
AGAGTTCATCAATTGTTCATCAGATGTAGGCTCTCCGCCACCTGACTCGGACTGTTGCTCCATGGTGTTgCTATCCATGGATTGTGCGTCGAAGTCGAAC
TCGTCGTCATCGATGAACACATCAGTCAAATTCCGGTTATTGAAGTAGCTCGTGTCATTCGGGCCTTCGAGTGTGGGAACGAACGGCGGAGTCGAATCCA
GGATTGTATCCCAGTCAATCCCACGAAAGAAAGGGTGCTTTCGTAGACCCTCCCAACCGAGACGCTTAGACGGATCGGGTTCAAGAAGTTGATTGATGAG
ATCAATTGCTTCGTTCGAAAGACACTTCTCGCCGTCGGGCCACAAAATTTGTCGTTCCAATATGTTGTTGAAAATTGCTTCAACGGTCTCATCATTAAAA
GGTGGAAAACCAACCAACATCTCGTAGAGAATGACACCAAGTGCCCAGTAGTCCACTGGCGGACCATGAGGTTTCGCCAGAATGATTTCTGGGCTGAGGT
AGTCTGGCGTTCCGCACCGTCCGTACGTATGCGAATATGCTCGTTtCTTTTTCTTGTGTTtCTTTGGACGCGTTGTCAGGATGTCCATGGTGAAATCATC
GTCGAAGTCAATCTGCTCGGGAGAGTGTATCCGGTGGAcATTAGAGAGATCCTCCTCCGTGCTAATGTCTTCATCACGAAACAGCCCATCTCCTGGGCTC
TCTGAGTCCGAGTCGCTCATGCTGACGCCTTCCTCGGATAAGCCAAAATCCGTTAGCTGATTGGAAGCAAACATGAATGCGGTAAGACAACAGTGTATAG
TGCAGAGATAGcTGGACTTGCCTTGATGTGTCCACTAGACGAAATCAGAATGTTATCAGGCTTCAGATCTCTACAGAGTCACTGGTGATTAGAaCAGCGA
ATCCTAACAATGAAAAGTCGTTCCGTACCGGTGGACGCATCCTTTCATGTGTAAGTGATTGAGTGCAAGTGCcACCTCCGCGATGTAAACTCGAGCAACC
TGTAGTAAtAaCACAATGCATAAGAGAGTCGTCGCCTGTCTCCATTATTCATGAACAAAaCATACCTGTTCTTCTAGTTGCACGATACATTCGAGTAGGG
ACATAAAGTCACCACCAGGTAGATATtCCATcACAAGAAAAAGGTTTCGTCTAGAAGCATGAAACATCCAGGTAAGCACTGACGACTGAGTCATGAATAT
GGTGGGTCCTCCAGCCTTACTTGGTTTGGAATGTCCAGAAGAGTTTGACGACAAAAGGACTCTCAACGCTGACCAAGATGTCTCGTTCTGTCTCTATGTG
TTGAATCTGCATAAAAGGGGCCATCATTAGTCACCTCTCCGATGGACAATCGAACATTCCGTGCGCACCTGCTTCTTTCGAAGCACGTGCTCTTTGGCCA
GTACTTTGATAGCATACTgATCTCCCGTGGTCTTCTTCCGCGCAAGGTaGACTTTGCCGAATGCTCCTTTCGAGATCGGTTTGATTATCCTGAAATCACG
AATAGATACTCGGCAAGCACTTGGACGCCTTACACTTGTGGGTGGTGGTGCTAAAACTCTTGACGTTCCGTTTTCCATTTCCTCGAGCGACTTTGTCCGC
TGGAATGGAGCGCGACCATCGTTTGGGGCTTGTTGCAAAAGTACTTTTTGGGTCTGACGCATCTTGCTCATTTTGGCGTGGACCAAGTTTCGAATGCGAT
GGCAATATTTGATACCCCTTTCAACACcAAAATTTGCAGACTCTGGCGGCTCTTGCTGTCGGATCCGATCGAGAATTTTGATAAGACGAGAACAAAGAGC
GAAGGACTCGACCTGTGATACGTCGCAGGACGATGCTTGAATCGCGATTACCcGAAGGgCATTATAGAAATGTAACGCTTCGGGGTGGAAATAAGTTCGC
ATCGTATCTGACTCGAGGTTGGCCTTGATGAAcATTGCCAATCGTGACAACGCATTGTTTATCTGATCTGCTTCTAGCTCGAAACGACGAGACATAACAC
AATAATTTGTGTGCTCGTCAAGACTCCATGCGTCCACTTTGCACTCACACAGCTTGCAGACGACCATCGATTCTTCACAGCGTCGAAAGCGAACTGAGAG
TGGTCGTTGGGTATACTGCAGCATATCGAGCACCTCCTCTGGCATGAGTGTCGAAACCTCTCGACCGTTGATGGCGTCGACGATTAAACCACGCGTAACT
GAATATCCAGGCGGGATCTGGAGGATGTTCTTGGACCACGACCCGGGCTGCACACTCTTCACCATCACCTGTCTCCGCGCATCATTGATGACGAACTCGA
GGCCGAGAAAGCCATCGCCGAACTTGGCCTCGAACGTGTCATTCCTCACTGTACTGACAAGTGCTGGTTGCGcGGCAGGTGCTCCCTCTCCCGGAAGCTC
ACCCGCACTTGGGGgCATCACACTCAGCGACAGCGCAGGGAcAaTGCCCCCTCCGTCGCCTTCACTCGTTGATGCGTCCATCTCTGCCAACGAGTCACTG
GATCCTCGAATCTGCCACCTCAGCCGCTGCCGCTCAAGCCGCCCGATCACCCCATGCGGCGACGCATTCGCTCGCAGCCCACGCGTGCTGTCAACTCCTC
CACCAGAGCTGCTGTAGGGCGGGATGTTGAGGCTGAACTGCCGCAGGAGTTTTCTCGGTGCGATCTCCTGTTGCAACTCCTcGTTGAGCAGTTCCA