Description :
From Genome Similarity Track
Location :
scaffold_46:36322- 37509
Sequence
1187 bases(100 bases per row)
agtccCCGCACAGCGCATCAGCTTGTGCGTATACTAAATGGATTTTGGCGCATCTTTTAGGCCCATAACAAGTTGACTGCACTAACGGTTCCGagcaaac
gccgattccgCGTAAAGATGTCATCATCCATCGGATTTCCGCTGTACAGAGCTTGGTGTACTCGATTGGTCGATGGAAATTAccaaatcttgatgaggga
AAGGATGCTCCTTCGACACACGGTTTGGTATGTTACAAAGTGGATTGTAATGCCACAGGGACTATTTAATGCCCCATTAACGTCCGATCGACTATTTCGA
CCACTGCGATGCTTTGCACAAAATCTTTTTACGCTATTCGTCCATTCAAGAGACGAAGGCGGCAGATCTGCCAAGGAAGTGCACTCGGAGCACTTCCGTG
CGGTGCTGTTATGTATGCGTAAGCATTCAATGCAAGCAAATATTGTAAAGTGTATTTTCGATGTTAAAGAACTGATGGTCCTTATTTGTTGTGTTGGTGA
ACACGGTAATTGCGCAGACCCTGAGAGTCAAGGCAATCGTGGAGTGACCGACGCCACAAAATCAAAGGGATTTGAGAAGATGGATTTGTTTCTTCGGTTA
CCTGCATCGCTTCTTGCGGAACTACGCGGACATAGTTCATGGCGTATCATGGGAGTGGTCATTCACTTGTGAAAGAACATTCACTTAAATCAAAAACAGC
TAACTGTAAACAGCATTTCTTTCTTTGCTAGGTAATACGAATCCGGACAGCGTGGTGTATGACGCTTTTGTGCTTGCGATCGGTTTTGCATTATGGCAAA
AGTAATcagaaggacacgatcgtgcCGTGTCGTTTCAGTCGCGACATCTATGGCCAGCAGAAAAGAGCTATCGTCCACGACCATGAGCTTTTATCAATTA
AATTTGCTCTGGTGAAGTTGGTGCTCCCCTTTTGGGCTCAACTCTGTTTGGTGTCTTCATGGATCATGCAAGCTTGCTTTATGCAGTTCAGTCACCTCAC
TTCTCACAGCAAATGGCTCGCTGGCTGTCATTCTTTTGTAAATACTACTTCATGGTCGCGTACAAGCCAGGGAAACTGAACGTACTAGATAcgcattgtc
acgtcgtcctGATTATGAGCTAGATCATATCGGCTATATCGAAAACGATGTCTTCGATGTGAAACGTCGAGCGTACGTTCAGGATGA