Description :
From Genome Similarity Track
Location :
scaffold_168:3632- 9377
Sequence
5745 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAAGTAGTCACGAAATTTTATCTAAATTCAATGCTTAATGTAAAAACGGAAATAAAGGTACGAGTACCCTGCTCACTCATCAAATA
CTATAGAACGATCTCAAGTAAAATTCACGTAGTTTAAATTCTATTCTATACGTTTGACTCGAAAATGTTTCTAACAACATACAGAATGCGATGTTGAACT
TGAAATTTCGTAAGTGGTCCACACTGATGCTCATTTCAGCGAGTACCCAAGATGCCCAAAATTTAACTTCTCCCTTGCACCTTACAGTAGCTTTTACCAG
CTTTTACCAGCTTTTACTAGCTTTTACCAGCTTTTATCCACTTAGATCCTAAGGCAGAAAGTATCACAATACCCCGCTGCGAGCCAAATacttctttccc
agcataggaagacgaggagggtGAGGTGTGCCGACGGCGCgccgtgagcccagctcgaaccttgcggacgcgTGTGCGTTCCCgttctctcgacttccgg
gggtggtattgttaccaatcgccccgacgaggcacaagagcagcaattggaggctgtgCACAATGCGGCTCTCCTGTGCTcctatccacgttcggtctta
gactttcgtgtggaatatggctctgctcggcggatcccacgactgaagcaaaaattgcgatctaggcgtctacgtagtcgggccgcCGGTTACAACACAA
TCTGAGCTTGAACAGCAAAAAGATCTGCGAGCTCTCTTTGTGGTACCGCAATAGATCACAAtagatcggtaccgcgctcaaaTCCGAGATCAAAAAGAAG
TCGCTCCtgtcccgcaatgcggactattttTCTGGTGCTcaccctggcgaaaccgctgcagataataATGAGTTAATTAAGCATTGGGTGCAGAGGAACC
GAAACCTTTCTACGCTGTCTTATACAGCgtagccacaaggaagtggacgtgcgcataAAACGCCATCTtatatttgagtttgcccaactcaaggcgcaac
gccgactccctgcgtattgtcgccctacgACAAATGGAATAgcccatcacgctcccgcgagctctgtggtttctcacacgggtaagTCTACACCCACAGT
AGCTcaaggccatagcttgagctcagcataTGGTCCTCCGGCTATCTGGGCtactgccaagaagcgcggAGGAGGGGGGCACGACGATGCTGagtgtcat
gatccttctgatcataagcgcccATGAAGTTGGGGCAGTCTTCCCGGTACctaaaactcccacgagttctcggagtcggaGTCTCCCCGCCGCTTCACGA
GAAATTGGGTTCGactctgtcgacgacgtcgacccacatgGCGTTCCATGTAgttgtggacgccaccattttcAACGAGAAGAGTCgtcggcggacgatg
acgacttggtcgatcgccgtccggtgactcgcgatgctcttcgagcgctgGAGGACAcattccgtcgtcatcgacatCCTGCCGACCATCTCTCTGAGgt
tgcctaccgctgtgcggaggACCACAAGAGCctgaagcactttgtgcaccgactgcctcacgttgaggattatcgcgctctgtcggagagGCTCCTAGCC
tttgagcagacgaatacgtcgcttcgtgcgacggtggagcgccttgcgccgtcggaaacggaagttgttgcacttcgcACTCGgaacagttgctggttta
gcttctgggtgggaGAGCGaatttgggcgccgccccggcgccaacgcttccgcgtttatgttcacttgcgccaaatcccggtacggctttatcaagccca
cataaatacCAGGTGGgcgcgcatccttctcggaagctTAAgcatatacgctaggcctcacTTGGCCACGATCTTAAAATGtctaataaaccgtggacgg
agcttcgtcttaaagtccgtagaaactgcatgtgtaggaaggttttgagcatttaataaaaccaaatCTCccacctcaatgttttcaacaattcttcttc
tttttagcTATGTTCGGGGCTTTTgttcgatacaccttcggtgtttgagaatcagatactccgatatctagcacattgaccgtcccggtccagtgcccgc
gccaatagcgcttctgttttctagtagaggtgggttcatgactcaccaaagctccaccaggaggcATGCGCGTTGcgtccaaggtctttgacctccattT
AATCcacggctcatggtgttcaaaACATGCCATACAAAGAATAAGgttataccttgcatccaagtctaagaccagacagcgttccacgctttcaaagtca
aggagcttgacaaacgaggtccacagggaccctcggcacagtgacagtgccactcaaccgcgcttccagcacttcagcatacagctgacttttttcgatc
gtggagcgtagACATGATCGCCCAAAAATTGATGAGGATCatcatggcttttcaaagccctttacggtcgcattacgaccagcaagcccggcttgcacac
acgttccgtgtttaagagcacgcagctcttcAGGGCTGAGCCCTGCTACCCTCTACCTTTTTGAGGCACAGCAGAACTCAATTCTCTCCCAGTGGGGCGC
CGCCAACTGGCTGTTTTCGTTTCCCGCGTCAAACTAGACTGCTtaaaagcgggacgtcggtccGACAAACCTatatgcgccttgcgcagggggcagccag
tccgaaggtgacaggtgtctccacagacaaagcaccgtcgggtgttttcacgctgctcagcagctcgaagctcttcttcctctttctcatcaTAGCTGAG
ACCCTTTTTTCGCTCGAAGATCTCTGAGGATGTGCATTTCAGCCAAGTCGCGCCGACTTGTAGTTTGATTCGGCACTAAATGCCACGCTCACCGCTTCCC
TAAAAGAAgacagatgcacacggaagactccattctggccgcgccagtgcgaaggacCTCtataaagacgatcactgcgaccgcctcgaggAGAGGATAT
GCTGCCATCTCGGCAATGAGtgctctcaactcttggataaAGTCCGCCAGCTCCTTTttaccctgtcgggcagcaaggaaacacccaatcaggcatatcc
ttacgcgatatgcctggttgggcggtgagaacacttGCAGAAACTGACGCTtaagctccttccaggaggaaaacacagcttcaactgaagcaccacacgt
tagtgcccattctcgcgctcggcctccGAgtttggagatagctagcgccacgcgctgttgctcgtttagGAGCACGGTGAataccatagccatctcggcc
tctcttattCGGAGCACAAGATTCTCGCCATCCTTACCCTTTAAGGATttagcgctcaccatgagcagcctgggtcggaaggaatcattcgttgtcgacg
gtggcgtcatagacgcagtcgacgctgacagcttctgcagtaattgctctagcagagcattctgATAATTTAAAAATCCCcccaggcgcgcgcttatgac
ctcgggcccttgcgcaacaatgtgctccacgccctcagggcccaacagggacatcagcttattaagccgtCCTGGATGCCCAGGGGCAAATAGAAGTATT
CCTCCATCATCAAAGAGAAAAGTCGTAACGACACAGGCGTAGATT