Description :
From Genome Similarity Track
Location :
Scaffold_472:3632- 5354
Sequence
1722 bases(100 bases per row)
CCCTTCGGGCTCGCAATATTACGACTGCAGCACTCTGAATAGATCCCGGATTGGTAGATCACGATCAAATTCTTGCTTCAGAGCTCTGCAGTTCAAATTC
TATTAGTCTACCTATGACATATCATTTTAAGTTTTCCAGTGTACCAAGAATTGACGATGCACTCGACCGTAACGTGGCTTTTCACCCGATTTTATGTGTG
CCATTCATTCCACTTCGAATTGATCATCTTCCAGACCACCTTCTCAAAATATCCTGCGACAAGGGTACTTCATCAACATTAACTAGACCCGTTTCATCCA
CGTTGAAACGACCGGTAGGACATTCTGGGAATAATCTCACATGGTTCGATTTTGAAACTTGAATTACGGGAAATAACCGGTAGGATGTACCCGCACTTTA
TAAATGCACCGCGTGATCTCCACATTGGCTCGTCACCCGAAACGGTACATGCCACATATGGGATATATTTTGTACATATCCGTCTTTCGCGCAATCCAGG
TAAAAGGACTCCCGCGATCCGCGGTCGACTTCCAGTAGATCTTAATTATCATTATGGGGATTTTGGATTGCGATCTTAAGTCGATAATTTGCGTTGGCCC
TAACACGCTGATATTTGTGCTGTTTGTTATATCGCCGTACGCTAAATCTCGATGACGCACCTCAGTAATCGCTGGTGAAATATTTTGTTTACGTGTTGCA
GGTGGCGGCCGCCACCCACGGCTCGACGAGGTCGAACACGTCTTCTTTGATCATATCCTGGTCGAACGTCGATCGCGGATCCCAGACGTGAGTCAGGTAA
AACGGTGTATTTCCGTAAGCACTATCTCGCGCGGTGTTGATCGCGTAGTTTTATCACTCTGCGTATTCGTTACAGTAATTTTGTGCTCGTCCGGAACATA
CGCCTAAATTGTTCATTTCAAAGTCTGCACTATGCGTTTATCCAGATGGTCCAGACGTTTGCTTGAGGCCTATACGCCGTAGTGGCTCGCTTTTTTGCCC
CTAATTCGGTTAAAACTCGAAAAAAATCAGTCATGGACTTCTGTTCTTCAGTGTGGAATATTGCTGTGCTCGTAATGACACGCCGGAACACACAATGTTC
GTATTCACCGCGATTGTCTGGGCAGTTTGAGTGAAGTTGCTTTCGCGATCATGTAGCACGAGAATATATTGAAGTATATCAACAGCTCTGCACTCCCTTT
AAATGATCGCGGAAACGACGGAATGTGATACGTAGCCATTATTTGAAATCAGTTAGTTTCTTTCAAGCGACTAGGTGACCCACCAAGATCGTATGGACGA
CCTCTGCTTGTCTTATAATCATCACATACATCGTAGTAACGTTGCACATTCCGATACCACCATCGCCAGCGAAAAGTCACCGTGATCTGTTGATATGATT
GCTCCTCCTGTGGTGGCCATATTTTTTTAAATATATATATGAGAATGGTGCAGGAAGGGTTGCTGCAAGAGTTCTAGGATCACTAAACGAATGGACTCCT
CATGGACTTTCGACTTAGCCGATATCAGGTAGAAAAACAACAAGCCATCGTGATCCACTTTATAAGAAGGCGCGAGCAGGGTGCAAACTTTCGCCTCTCC
TGCCTGCTATTCGGCTATATTCCCGATCATGTATTATTTTTACTCGGACATCCATTTAATTATCCTAAGATTGTTTTCTTCGATCGATCAATCCTTACTT
GGTCCACTCTCTACTGTTGCAT