Description :
From Genome Similarity Track
Location :
Scaffold_294:3632- 4758
Transcript NameFunction/comments
Hyaar_Emoy2813569DEAD box helicase putative

Sequence
1126 bases(100 bases per row)
CGGCGAGGACTTCGCTGCGCTGCCACTGTCTGAGCCCACACGTAAGGCGCTTGCTGACATGGGCTTCACAAAAATGACCAAGATTCAGTCCAAGTCGATT
CGTCCGTTGTTGGCTGGTCAGGATTTACTGGGGGCAGCCAAGACGGGTTCTGGAAAGACGCTGTCTTTCTTGATTCCGGCGATTGAGCTAATGCATAAAG
TGCGTTTCACGGCACGCAAAGGAACGGGCTGCATTGTGATTTCGCCAACTCGTGAACTGGCGCTGCAGATATACGGTGTTGTGCGCGACATCTGCAAATA
CCATTCACAGACGCACGGTATTGTCATGGGAGGCGCTAATCGCCGCGCTGAGGCCGAGCGTCTAGTAAAGGGTGTAAACATTCTCATCTCCACGCCTGGC
CGTCTGTTAGATCACCTGCAGAACACGAAGGCCTTTATTTATCACAACCTGCAGATTCTTGTGATTGACGAGGCCGATCGTATTTTGTCGATTGGTTTTG
AGGAGGAGATGCGTCAAATCATCAAGTGCATACCCAAGGAGCGTCAAACGATGTTGTTTAGTGCTACGCAGACGAAGAAGGTTGAGGACCTTGCTCGTCT
ATCCATCAAGGAAAAGCCGGTGTATGTTGGTGTGGAAGAGGAGGATACCAAGGCTACGGTGGCAACGCTCGAGCAGGGATATGTCGTTACACCGAGTGAT
AAGCGCTTCCTGTTGCTGTTCACGTTTCTCAAGAAGAATCTGAAGAAGAAAGTGATGGTGTTCTTCTCGTCGTGCAATGCAGTCAAGTTCTACGGAGAAC
TTCTGAATTATATCGACATTCCGGTGCTAGACATTCACGGAAAGCAGAAACAAAACAAGCGCACGACGACATTCTTTCAGTTCTGTAACGCGAAGACAGG
CATTTTACTCTGTACCGACGTGGCGGCGCGAGGTCTCGACATTCCGGCCGTGGACTGGATTATCCAGTTTGACCCGCCTGATGACCCGCGCGAGTACATT
CACCGTGTCGGTCGTACCGCTCGTGGCGCCAAGGGCAAGGGTAAGGCATTGCTCATGCTTTTGCCGGATGAACTTGGCTTTTTGAAGTATCTCAAGGCTT
CAAAGGTGGCACTGAATGAGTACGAA