Description :
From Genome Similarity Track
Location :
scaffold_46:36315- 37497
Sequence
1182 bases(100 bases per row)
cgtgagcagtccCCGCACAGCGCATCAGCTTGTGCGTATACTAAATGGATTTTGGCGCATCTTTTAGGCCCATAACAAGTTGACTGCACTAACGGTTCCG
agcaaacgccgattccgCGTAAAGATGTCATCATCCATCGGATTTCCGCTGTACAGAGCTTGGTGTACTCGATTGGTCGATGGAAATTAccaaatcttga
tgagggaAAGGATGCTCCTTCGACACACGGTTTGGTATGTTACAAAGTGGATTGTAATGCCACAGGGACTATTTAATGCCCCATTAACGTCCGATCGACT
ATTTCGACCACTGCGATGCTTTGCACAAAATCTTTTTACGCTATTCGTCCATTCAAGAGACGAAGGCGGCAGATCTGCCAAGGAAGTGCACTCGGAGCAC
TTCCGTGCGGTGCTGTTATGTATGCGTAAGCATTCAATGCAAGCAAATATTGTAAAGTGTATTTTCGATGTTAAAGAACTGATGGTCCTTATTTGTTGTG
TTGGTGAACACGGTAATTGCGCAGACCCTGAGAGTCAAGGCAATCGTGGAGTGACCGACGCCACAAAATCAAAGGGATTTGAGAAGATGGATTTGTTTCT
TCGGTTACCTGCATCGCTTCTTGCGGAACTACGCGGACATAGTTCATGGCGTATCATGGGAGTGGTCATTCACTTGTGAAAGAACATTCACTTAAATCAA
AAACAGCTAACTGTAAACAGCATTTCTTTCTTTGCTAGGTAATACGAATCCGGACAGCGTGGTGTATGACGCTTTTGTGCTTGCGATCGGTTTTGCATTA
TGGCAAAAGTAATcagaaggacacgatcgtgcCGTGTCGTTTCAGTCGCGACATCTATGGCCAGCAGAAAAGAGCTATCGTCCACGACCATGAGCTTTTA
TCAATTAAATTTGCTCTGGTGAAGTTGGTGCTCCCCTTTTGGGCTCAACTCTGTTTGGTGTCTTCATGGATCATGCAAGCTTGCTTTATGCAGTTCAGTC
ACCTCACTTCTCACAGCAAATGGCTCGCTGGCTGTCATTCTTTTGTAAATACTACTTCATGGTCGCGTACAAGCCAGGGAAACTGAACGTACTAGATAcg
cattgtcacgtcgtcctGATTATGAGCTAGATCATATCGGCTATATCGAAAACGATGTCTTCGATGTGAAACGTCGAGCGTA