Description :
From Genome Similarity Track
Location :
Scaffold_91:36311- 38521
Sequence
2210 bases(100 bases per row)
TTTGGTCATATCATACGTAGGAGGACCCACCATCGGACCTGCGTATTCTTCACAACCTTCTTACACCCGCTCTATGGTGGCTTCAAAGTATAATGTTTTA
CACTCGATGTAACATCGTGATCCGAGGGATCACGACGTTACATATCCATATGTCGGATTCCATCCACAGACCCGACGCGGCTCCATAAATTCGAATTAAG
CCACGACCGCTGATTCTTGTGATCTTTAAATACTTGATCTTGCCAGACCAACTTATCACTTCTGGCACATAATCTACATATTTACCCATCCAAAGTTCAG
TCTTAGGCGAACTAACACCGGTAGTTACTTTAATCGATCTGCCTATAGTGATAACTACATGTTGATCGTCTGCATCGTCAATCGATATGACGATTTCCGT
CCTGCCAGACCTATACGTACTTCGTTTTGTAGACACACGGTTTCTCCGGGTAAATTCAAATGTATGCCCGCCTAACCCATGAAATCCATACCCAATATGA
CTTCCCGGACGACGTGGTCACTGACTTATGCGTCGAAATCATGTACCAACGATCCGACAAATTTAGTCTTTTTCTTTCCTCTGACCCATATTAATGTATG
CATTTTCTCAGATCTGAAGGCACTCTTGCGTTTCCTTTCTTCAATCACATACTATTGTGCGAGCAAAGGTAGTATCAATGATCGATACTACAGCACAAGA
ATCGAACAGCAGAGTGGGTTTCCCATCGTTATTCTTGCCCACTTCTTTGCTCGATTTGTCCATTTTCTGGGAGTGTGATAATTTTCTCCGCGCGTTTTTC
CTGGTGCAAGATCGTGATGTATCCTCCCAGGCGATCAAGTAAAATCATTCACAATTCTTAAAGTCGACATTGAAGAAAAATATAGAATCATTACGTATAT
TAGCGATCGGATCAATATAAGTGGTAACCTCTTTGTTTTTCTGTTGTCTATCAACAAATGCATACATTCAAAGCCTAGAGCTCTCGGCTCGTATCAGATG
CCAATATGGCAAGCGTCCAAGATAACCATCTGCTCCACCTAAGGTGGAAATAATTCAGCAGGCTTGGTGGACACGTACGACTTGCAATTCAAATTGTAGA
GGTTTTCTACAGAGCATTTGCCACTTTCATGCATCTCTCCGCAACCTGCACAAACGTATAAGCAGTCCTATGGATGTTCCTCGCGACCGCATTCGGTCAA
TTTAATGTCTCTATCTTTCCTCGATCATCTTGTTTCGTCAATATGCAATGGTTGCATGCTCTTGAGCGTTCACTGCTATCGCGTCCGTTCCAATGTTTAC
ATGACTTTGACAAGTAAGAAGATCCTTGTCCGAATCCTCTCGATTGGTGTGTTCGTCACAAATATTTAACAGCGATATGCATCACCATCTTATCGACTCC
GAGTACGATTCGCTGCCCGTTTTATTTCTTCGAATTGCTCGGACAGCCCGGGTCTGTCCTAAATGCACCGTACTTGGGGGGCCGACCACCCGCTGGTGAA
CCTTGCCCTTGCCGGATCCCATCGACGTTTTAATCTGGCGGGTCTCCATCCACTGGTACGCACGTAGAGTTTCCTCCATCTATTCGGCGTCCATCAATCG
CAATATAATACGTTGCATGGCCAGATACCGATCGTCTAGTGTCGCGATATATTATCTTACATATACAAGACATGTGGTCATAATTCTCTCGCGGATATCG
ATCTTGGCTAGGACCACTACGTAAAGTAGGTATAAATACTCCATGGAAGATTCATCTGATCGCTTCCGTGCGTAGTCATATTAGCTAAATACTGAATCTT
CGGATTCTTTGTACTGTAAAATACAGTATTTTTTGTAGCAATAGTTCCACTTGTGACGGACAGGTCGAGCTCAGCTGGCTGTACCAGTTCCGCTTTGGAC
TTTTCAGAAATTGATTAGACACCAAACCAATTTCTTTGTCCGGAGTTTGATAACTCTGAGACGCCGACTTGACCTTTCTGTTCCAGCTACTTAGTAGGTC
TTCGTATCGACCCTGTCATTAGAATCGTCCAGTGCCGCGATCGCGAAGACATGAATGCGCTGCAAAGTGTTCCACCATTCGGTGGCCTTCCGTTGTGGAT
AGTAACGGAAGCCATATATTTTCTTGCTCCAAACCGTAAGGACCGTCATCTTCATGATCGTAGATTTCCGATCAACCATTGTGGAATCCAACCGATTCCA
TTTCGATATC