Description :
From Genome Similarity Track
Location :
Scaffold_414:3631- 6234
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_414-fgenesh-gene-0.2Cysteine desulfurase 1, mitochondrial

Sequence
2603 bases(100 bases per row)
AGTCGCCAGGCTGCTTCGAGCCCGGCAGCAGCTGGAGTACGCTCTCTTCTTCCCGAGCCAAGCCTGACTTGGGGCGCGGTGGACATTGCTGTCTTTCTGA
TCTCCAGCCGAGCTCTTGTCACCGCGACCCTCGCTACGCACGAGCTAGGTGTCACGGTTCGCGTCGTTTGTGACGCCCAGGAGCTCAACAGTCAGTATTG
ATTTGCTCGCCTCCTCGTTGTGGTGGGTATACAAGTACGTGCAGCGGGCAACCAACATGGCTTGCTGCACCACAAGTATACCATCATCGACGCACGAATC
TGCTCAGTGGCTTTATCAACTGGTCGCTATCTGGAATTGAGCGCAACCACGAGAACTTGATAGTTCGCAAGGGTGGCCCGCTCCCTGTCGAGTTCAGCAT
GAACTTTGCGACTTGTGGTCGATCTGGAGTCGACCGTGGCAATCACCAGCCACGGCGACCCCCGCGCCGCTTCGGATCATAGTTTCACAAGCCAGCAGCA
CTCACATGTCAGCCGTTTTTTCCGTTTCATTTGTTTTAACTACCTCACATAACCGAAATCAATTAATCCTCCTTTTATTACAGTACTTTGTGCTGCGCAA
GAACGAATTAACAAGCAAGTACACACACAAGCTACGCAACAAGACCAATACGGCCAGCTCACCACCAGTGACGCCGACGGGCCTAGACGCGCGCGAGCTG
CTGATCCTCGAGCGCCAGCGCAAGATGGCCAAGGGTAACATCTTGCTCTTCGACCAGCTCCAGCCAAGCAAGCTGCGCAGCTACGTCGTGCTGACCGCCA
AGGCGCCGCGCTCGCCTGACGCGCCTACAGCCTGAGCTCTACGACCAGCAGCACCAGCTCCACCGCCAGCGAGGACGACGACGACAACGACGATAACGAC
GAGCAGGAGCTGGACGATGACGGCGCTCGACTGCAGCATGAAGTACGATTCGTACGCGGCCGTGACGTCGCGCTACAACNNNNNNNNNNCTGTGCTGCGC
AAGAACAAGCTAACAGCAAGCACACGCAAAAGCAGCGCAACAAGACCAATACGACCACCACGAGCNNNNNNNNNNAGTCAACGGCATGCTCGTGTGCACC
GAGTTCCGCCACGTTATCACCGAGTCCAAGCGCCTGCTGCTCGCGNNNNNNNNNNAGCAGCAGCAGCACAGGCAATGGCGGCGGATCGCCGCGCGAGCTG
CGCTGGAGCGATCTGAACCGCAGCAGCGGACTCCATGGTCCGCGCATCGAGCTCACCAAGTTCCTGAGCATCAAGTCGAGCCAGAACGCGCGCAAGCGGC
AGCTCAAGAAGAACGCGAGCAGCTTTGCTGGTACCAGTAAGAACCAGGAGAATGAACTCCTGGAGATGCACACGCTCGAGCTCTGCCTCGAATTCCTGGA
CGTCGACAACCTGGTCAACGGCACGCTCGTGTGCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATCTGCGCCGCGTCCGTGTGGAAGAAGACCTTGCGCGCGTGGCAGAGCGCGCCGATCTCC
TTGAGCGGCTGCACGACGCCGATCTCGTTGTGCACGGCGATGATCGACACGAGCGCTGTGTTGGGGCGGATTGCGGCCTCGAGCTGCGCGAGGTCGATGA
GCCCGTTCTGGCCCACGGGCAGGTACGTCACGTCAAAGCCCTCGGACTCAAGCACGCGGCACGAGTCGAGCACGCACTTGTGCTCGATCTAGGTCGTGAT
GATGTGCTTCTTCTTGGCCTGCCTGCGAGAAGTGCGCGATGCCCTTGAGGATCGCGTTGTTGGACTCGGTCGCGCCGGACGTGAAGATGATCTCCTTGGC
GTTGGCACCGACGAGGTCCGCGACGCTCGCGCGCGCCTTCTCGACGGCGGCGTCGGCATCCCAGCCGTACTCGTGCTTGTTTGCTACGTGGAGCCACTTG
AACTGGAAGCTGTAGTNNNNNNNNNNACTCGGACTTTGTATCAAAGCTACCATTGTGGCTCGCGTCGCCATATCGGAGACTGTCGACCTTGGGCAGCTCA
TGCAGGACTAACGNNNNNNNNNNGTCCCAGCCGTACTCGTGGGTCGTCGAGTGCGGGTTCCCGAACGCGTACGTCATGTGCGGCAGCATGGCGTCGAGCA
CGCGTGGGTCCATGGGCGTCGTGGCCTGGAAGTCCAGGTATGCCGGCTTGCCCTGCGCCTTTGCGGCGCCGTCAGTGCCTTCCTTCATCGAGAAGCCCGG
CGA