Description :
From Genome Similarity Track
Location :
Scaffold_1941:3631- 5673
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1941-fgenesh-gene-0.0Rab32 family GTPase
Pytiw_DAOMBR242034maker-piw_contig_1941-fgenesh-gene-0.2ATP-dependent RNA helicase dbp4

Sequence
2042 bases(100 bases per row)
TCAAAGTGCTCGTGCTAGGCGACGCCGCTACGGGCAAGACGAGCATCATTAAGAGGTGCGTGCTGTTGCCATGTGTCTCTTGCGTTATGCGCTCTTGAAG
TGCGAGCGCGGAGAAAAAAAGGTATCCACTATGGGCGCGAGGAGCTACGCAAAGCTAACGGGTGTGTTTGTGATGTGTATGTGTATGACTGTATGTGTGG
TGTAGATACGTGCACGATGCGTTCTCGGAGCACCACCGCACGACGATTGGCGTCGACTTTGCGCTCAAGGCCGTGACGGTGAGCGGCACGACCGTGCGGC
TGCAATTGTGGGATATCGCCGGTACGTGTGCGCCAGAGTTCTTGGATTGAGCCATGGGTGTGCGCATAGGGTAACATCTTGGGTGATTGTTGTCTTGTGT
GTTTCTGTAGGCCAAGAGCACTTTCGCGCATTGAACCGAGTGAGCATCTGCTAGAGGATCGGGCCATTAGCTGTGAGACCTGTGGACTGATTTTATACGG
ATCGTGTGTAGGTGTATTACAAGGACGCGCTCGGTGCTCTGCTGGTGTACGATATCTCTCGTCCGGAAACCTTCGAGAGCGTCATCAAGGTATGAATGAG
CGTATCCTTTTGTCGGCGGCGTGGTACCTCGCATTGAGAAGTTGACACAAGTGTATGTGGTTTCTAATTCATTCTAACCGATACAGTGGAAGAAGGAGAT
CGACACAAAGGTGCGCTGAGAACGTTGCGGTATTTTAGCTCGTATTTACCATCTGTCAAGTGCTGATGCGTGTTGCTATGCTTTTAGGTCGAGCTCCCGA
ACAACAAGCCGCTCCCAGTGATTCTGTGTGGCAACAAGGTAATGATCGTCTGCCAGTCTTGCCTCGACAATTCAATGTTGGCTCCAGTCGCCTAATCTAA
TTTGTGTGTATTTTCTTACTGTCCAGTGCGACTTGTCTGGAGACGTCGATCGCAACTTCTTGGACGCATTCTGCGAGACGAACGGCTTTGCCGGCTGGTT
TGAGACGTCGGCGAAGGAGAACAAGCACATCGACGACGCGTCCAAGGCCCTGGTGAACAGCATCCTGGAGCACCAGGATATCTTTGAGCGCAAGTCCGAC
GTGAGCAAGCGCAACGACACGTTCCGTCCGTCGCACGCGGACACGAGGAGCTCGCAGTCCGGCTGGTGCTGCAGCAGCTTTTAAAATGTCGAGACCGTCG
TGAACAGAGGGAGCTTTCTTCTAAGCCACCGCCACCATTTTACGAAGACGCGAGGGGCTTTAGGTGAGTGACTCTGACCCGTCATTTAGCACGAGCCAAG
AGAACGCCCATCGCTACAAACAAATGCTATGAACCCTTGCATGAAAGAAAAACCATTTTCTCTTTCTTTCTCATTATTTGTGTTGTTCTCTATAGCAAAA
TGCGAATATAAAATGATAAACAGACATGCGTTTATCGCTTCTGCAGCAGACGCAGCGCGAGCTCTTCCTGGCTCGCGACGGCGTCGCGACTCACCACCTT
GCGCTTCTTGTCGCCGTCGTCACTGTCGCTATCCGCATCGTCCTCACTGTCGTCATCGTCCTCACTGTTGCCCTCAGCATCGCTGTTGCCGTCACTCTCA
TCATCATCGCCGCTCTCCATGTCCTCGTCGGACGACGCGCCACCAAGCACTGCGCCCACGGGACCATCCTCGTCGTCGTCGTCCTCGCCCTCGCCGTCGC
GCTCGCCCTTGGTCTTCATGCGCTTCTTGTGGTGCTTGGCACGCACGCGCTCCTTCTCGAGGCGGCGGTCCTCGGCGTCCTTGTCCTTGAGGCGCGCGGC
CACCTGGGCCTGGAACTGCTTGGACTTGGCCTCCACGTCGGCGAACTCCTCGTCCATGTCCAGGTGCTGCGCCGCCATCTGCTCGAGCACCTTCATGCTG
TTGCCGTCCTCGTCAAAGACCACGCGGTTGTACGACACCTCGTTGTCCACGCGGATCTTCTTGGCCTTCTTCTTCTTGCGGGACGCGTCCAGGTCAATGA
GCTCCTCGTCCGCCTCGGTGTCGTCCTTGTCCCAGTCGTGGC