Description :
From Genome Similarity Track
Location :
Scaffold_31:363066- 367621
Transcript NameFunction/comments
Phyci_221281Hypothetical protein
Phyci_65072Hypothetical protein

Sequence
4555 bases(100 bases per row)
GCCTGCATTGTGTTGAAGAGGATGTCCAACCGTGGTCGAACTTGACGAGCTGAAACGACCAGTCACGCGGTGTAATGAACTGGAGATATTGTCGACAGCA
TCCTTGAACGTGGAAATTGCCTCGTCAAGAGTTATACCATCGACGGTACCATAATGCATAAACTCCTCTCTGCGACTGGGTGGTCTGTTCAGGTACGCAT
CGTAGGCCCGGCGGCTCTCTTTATTCGATAGTACTTCGTAGGACTCGGCCAGCAACTTGAAAATATCTTCAGCCATCTCCTTTTGCTGATCTGTTAGTGA
TCCGTGCCTAATCCGATCCGGGTGCCACCGCAGTGCGAGAGATCTGTACGACCTACGAATTTCCCGGTCATTCGCATTTCGAGCTACTCCCAGGCGCTCG
TAATGGTTCATGGTCGCATTAATCTGGATGGACCTAGACCGCCGTGCAATAGCATCAACATAAGCACTCATCATGTGCTGCAAAATAGAATTGCCAGTAA
GTCCTGTGGTAGCTTCGTCTCCGTCCTCCCCTAGCGCTTTTCGAATCTGCATCGGCTCCGAGAAAATATTGAATTCTGCGCTTTCCTTCGCCATCATGAT
ATAGGTTCCACATGGCGCGTATCGATAATCCACTGCCTTCACTATGTTGAATTCACGAAGTTTGTCAAACGTTTTTTGCAGCATTGTGATGCTCATGGAC
AAGTACGCCGACGTAGCGCTAGGAACTGCTGCTGTGCCAGCACCCTTTGCCATATCGACAAGGTGCTGCTGCATTGGCGCTGGTAGTAGGTTGAGCAGTG
CTTTTGTTGCCTTCGCAATAGTTACCAGTCGTTCTGTCGTTTTGGCGAGCATAGCGGCCGAGTGCGCAATATTCAAAATTCCAGGAATGCAATCAAATTC
GTTGACAAAGTTCACCACGCGATCGTCCATCCCCAGTGGCTGCAAGAATGCTGCCAAGGCATCGTTGCCAGCATACGGTGCACCAAAGCCAACCGCCATT
GCCACCGGAAGGTTTCGAAGCGCCCTCTCGCAGTCATTATTCCCCACTTTCCTCATCCACCCAGTGGGCTCATTCTTCTGTTTCTTGTGCTTTCGGAAAT
GTTTTTCCTTGTGACTGTGCTCGTTGCTGTCAGCTTTCGGTTGCTCCTCGTCGATTTTTTCAAGGATCTCTCGCACGCTCTTCGGTAAACCAGTGAACAC
GAGCTCACAGAACGCCAGCTGGGCGATACTGCCGCCGATGGAGTGTCCACAGAGCAGCAGCACTTTATCTACTCGTTGCGCTTCCCCATAGAGTTTCTCG
ACGTCCAATCGCTGCGCGCGCTTCCAGAACGGCGCGTGCACGCGAGACCCGCCGAAGCGGTGCACGAACGGCTGCGAGAGCGGCACGGCGGAGCCCACCA
CGGCCTGCACAATGTCGCCCGGGTTCGTCGCTCGCATGGCGCAGATGACAGCTCGATCCGACTCCACGAGCACGTAGTCGGCCGTGAACTCGAGCACCGG
CAGCTGCAGACTGTGCGGCAGCGGCGACTTGCGCACGTGCATCTCCAGCTCACGGGCGGCGCGGGCATTGGCCAGCGCATCAGACGCCGACGGCCCCGCT
TTGGTCCGAGACAGCGCGGCGCAGAGCACGGCTGCGCTCAGCAGTTCCGTCTCGTTGCAGGTGATGGCGCGCATGGCGGCCGGGTGGCCGCTGGCGCTGC
GCCACCACCACGCAGGTTCTGCCTGCTGCAGGCGCTCCTCGTCGAGCTGCGGCGCCATGCAGCGGGGTTGCTGGCCAGATGACGTGTGGTGCCGAAGACG
GCCAATATGTCAGATCTGTAGTCATTTCTGAGAATATCAAGCAAACAAACATTCTCGTGCGCGtaccgcaacgccgatgtcattattcccgcatatatta
gacctccaaatcagaatttgacaactacgcggcgagagggaaaacgaaggtgcgacattttagggtattcatctctcggccgaaaggtgaccaattgaaa
aagctgagaagatatgatcagtcgttcacttggtcgtctccttcgtgcgtgcacgaatcgcgcgaattatctctgcttttcactcagtcgctgcatgtca
ttcttcaaaatcccatctcgctaccgatcatcatggctcgctccactcccagcacccGATCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGGACAACCCGTCCACATGCCCCATCGAAATACCAGGCTTGTGATGTACCTCAAAGTGACGATCCGAAATCTCCAT
GTACCCTCCTTCAGCGAGTCACGGCACGGTTGCTGTTCGATAGGTGTGCTGGCACCAGCATCAATCTCAAATCGCAGCAGGTCCGTCCGTCCAGGTTTCT
TTAACTCCACAAACATCGCGGGGAAACCGTCCAGCTCAGCCTGGAACAGTTCCCTCTGTTCGAGCGACAACTTTGGCTCAGAGAAGTCGGTCACCATACC
TTCGTTTTTGTCGGGCGGGATGTCCGGCTTGGTTGCTTTCACCTTTTCGCCGACATTCTCCACGTGTTCCTCAGACGTAGCCACCACGGACCCACCTTTA
GTCTCCTTACACTCGGATGCCATTTTCTCGCTCGACGCCTCCGGCAGAGGTCCGAACGCTGACTCGGGGATGACTGAGGTGCACGCCACGACCGTCCCCT
TCCGAATTCTACGCTCGATGTTCGTGTCATGTTCCGGGAAAAGCTCCTTGTCGTCCAGAACCTCGGCGTATGGTTTAAACAGTGAAGCGAAGCCCAAACA
TTCCAACTTCGCAGGTAGCCGGCGACGGCGTCGTTTAGCACTTGCCGTCCGCGATCGACCACGGCAATACCATAGTTTCTTCCAGATTTGCCCAGCATTT
TCATCGAAATAGACTTTGATTTGTATCATCACGTCTTCATCATAGCGTTCGCTTACTCCATACTGCTTTCCAATGCAGTCGGCATGCCAACAGAGCCAAT
CGTCATCACACGGAGGTACTTTGTCCCTCAACGGGGGCACCTCATCCGTGCCTCC