Description :
From Genome Similarity Track
Location :
Scaffold_109:36306- 40314
Transcript NameFunction/comments
Phypl_g3325hypothetical protein PHYSODRAFT_485908
Phypl_g3326HSF-type DNA-binding, putative

Sequence
4008 bases(100 bases per row)
agctctcctcctccagcttcctcGCAACCGCCGTTGCCGAAGgtttctcctcctcttcatccacCGTCTCCATCCTGTCCGACTTGGCCTCAGCCGTCGC
AGCAAGCGTAGCATTACCAGCAGAGATCTTCGCTTCATCCGCTTCCATCTCCTCAACAAACGCAGGCAGTGACAGCAACGCGAACGTGTTGGGCGGCGTG
TACGGGAACTTGGCCTCCAGAAGGACCGCAGCGGTcgtggccagctccaccttgaCTGCATCCGCCACTGCGGTATCCTGCGTGTCTGCACCTTCCTCCG
TCAGTAGTTGCAACAGTTGGGGCAGCACCTCCGTGAAGATGGCTTCACTAGCAGCCGGGTGGGTCTGCAGAGCCACGGCCGCATACTCGCACGCCGGTCG
CAACAGAGAATTCAACctctgcgtcttctcctcTGCCCCAATACTCGCATCCTTGAAAAGCGGGAACAGCCATCTCAACTGCTTCAACACGTCGCCAGCG
GGCACTTGGTCGCCGAAAGACTCGAGCACGCGCGTAGAGCCCATCAAGGCCACCACCTTGAGTCCGTAGTAGCACTTGTGCGTCCACGCCGGATACTGCA
ACACCTTCTTGAAGGCATCCTGGTACCTCTGCAACAACGGCGTCATCGCTTGTCTCTCCGTCACGTACCGAACAGTCTGTAGCCATTATAAAAAATAAAA
CATTAGCCATCTAATGTAGTTGTAGCCAACAGCATGGGCGTGTTCATTACCAGCGACGCAGCGGAGAGCAGCGTGCCCAGCTCCACTTCGTGGTCGTGGA
TCAGCGCTTGGTGATTGGCCGGCGACGGGAGGAACTCGCCaatggcgtcgtccagctcctcaatcacttgcagcaggaagacgaaggtggcgtccacgcc
gacgCTCGTCGAGTGCACGCACTCCTGCACGTAGGCTGGGAGTGGCAAAGGCGCGAAAAGTCAATGGAAAAGCGCGTTACGCGTGGCAAACAGCGTGGCA
AACGTACCGGCGACGCCTCCCGATTGAGGGTCCAGCAGGGCGCGCGCCAGATCGCGCTGCATGCGGCGCGGCGGAGCCGTCTCGGAGCTCATGGTGGTCG
AAGTGGTCGAAGTGGTCGAAGTGGGGGTAGCCATCTCAAAATGACACGCAAATCATGATTTGGCCGACGCTGTTGGTTGGCTAAGCGGGGATCAATTCAT
ACGGCATACAAATGTCAAGTGTAATAATTGACAAAATAGGGTCCTGCCGCTTCAACATGTCTCCCGAGCTGAAAAGTTTGGCAAAGAATGCAAAAGGGGG
CGCAGAGAAGGCTTCGGCACGTTGCAAAtggcaacagcttcaacgccaaGTTAATGTGTGCAAtcgcttgagcttgttgccGATGGCAATCGGTAATCGG
TTCGCGCCGGGCTGTTCCATCAAttcagcgccgtcgacgcctcGCTCGTTTGGCACCATTGGATTTGTCTTTGGTACAGTAGGAGACTCGCGTCGGCCGA
TTGCCGCTCGGCTTGGACCAGGTGCCATCGCCGAGTTGTGCCGGCCAGTGATTTCGCTGCTCAACAACACACGCGCTTCGGTGGACGAGGCACCGTGaat
ccgccgccgcgtgcaAACGGACCGCATCCCGCCCGAGAGAAGGACGGCAGCAGATCGCTTGCCAGCGACCTTCTCGATGGTCAGCGCCGGCACGCGAGAA
GCGCTGGCCCCCTCTCTTCCAGTGCAAGCCGCCGCTATCTGCTCAAGAGTGCATGGCGCCGAGGCGCTCTATTTTTCACGATAAAATCGAAGCCGTGACG
GTTCCGATCCTCGCCTGGTCTGACGCGGGCTTCTCCGGCTCATTTTCCCATCGGCTTTGCTACTGGTGTTGGATGCGAGGCCTTCACTGCTCGAGCGGTG
GTGGCCTGTGCCAAAGTCGCCCTGGAGCTCCGAGCTTACGGCACGCGCTGCCAATTGCCACTCGGAGCATTGTCGTCACGCGGCTGCCGCCAAAATAGCC
CCAAGCGGATATCGAATCGAATTAAAATACCGCTCAACCTTTGTGGCGCTCGGCACTACAAGAAATCGCGTATACAAGTACTAAATCAACTCCCGTGCTG
TACAAGTTGCATCGGCCGATGTACGAGGCCggagtacatgtagcattTCGCTAAGGCCAGCATCGCAGTGGTCGATTTCGCTAGCTGTCAGAGACCTGCa
aaaaagaagaaaacaATCCCAGCCATTCAGCTTGCACAGCCGACAACCTGTCCATGTCGAAGGCCCACAAAGGCCTCTCGGCGAGAGGCCTTTGTGGGCG
AGTCTCGGTGTTTCCCCAAGGCCACCTCCGACATGCCAGAcaacgctgcagcactcgacgGTCGAGTCGACCAGCTTTCGTCCCTCAAATCGGCGATGTG
TAGCCAACTTGGGCGCGCAGAGCGCGGGCGTGAGTCAACAAAAACGAGAACGACGGGAAAATGGAAACGGCATGTCTCGACGCAGCATCGaggcgaggag
gagggacCGACCTCAAAGCTCCTCGCACACAACCGAATCGAGCGTCcgcctcgcagcagcagcgatggcgtCGGCTCAAGTCGAGGGAGAAGCCGCGGGT
CAGCTGCGCATCCGCGTGTCTGCGCCCGTGTCCCCCGGCCCggacagcgtcgacacgcccgacggcagcgaaaccgcggcgacggcggggCGCGGCGTCA
AGCGGCCGCGGCGCGAGGAGGCCGCGCTGttcctggagaagacgtACGAGCTGTTGGAGCGCTGCCCGCCCGAGCTGGCCAGCTGGACGGCCAGGGGCGA
CAGCTTCGTGGTCAAGCAGCCCGCGGCGTTCGCCGAGCGCGTGATCCCCGCGTACTTCAAGCACCGCAAGTTCAGCTCGTTCGTGCGCCAGCTTAATCTC
TACGGGTTCCGCAAGGTGCGCgccacgtcgacgccgacgtctgTGGTGGGGGAGACGGaggcagaagctgcggagGACGCGAGTTCCAAAGATTGGTGGG
AGTTCCGTCATGAACGCTTTGCGCGGGGACGGAGAGACCTGCTGTGCGAGATCAGACGACGTTCGCCTGCTAGTGATAATGGCAGGACCTCCACGCCGCT
AGGGGTAGGTACCCCcgtggagcgcgtcgagttcgaggagctgaGAGCCGAGGTGAGCGGTCTGCGCGAGGACATGCACAAGATGCGGAAGACCAATCTG
CAGCTGACCGGACTGCTGCACaatctgctgcagcgattCACCGAGAATGACCGACAGGAGCACGCCCAGACGCCGGGCTTTGCCGTCCCTTCCCCTTCGG
GAGCTCAGGCCCAGCCGAGATCCCTGCCATCGATAGCTTTACCCAGTCCAACAGCTAGTGCCAGCCTTAGCGGGCCGCAGCTAGCGTTACTACAGCTCCG
TCAGGGACTTCAACCGCAAGGTACGCCGCGGGACATCTTGACACCTCGGACCCCCGCTTCGGGGTCTTTTCATTTACGACCGGTGCAGTCGCTCATGGCG
AATCTGAGCCCCAGCAGTCGACCAACGCCGAGCCCGCGACCCAACCATAGCTACGTCGGCACGCCTTCGTActgtcagcagcagcagcaggaacaacTCA
GCAGGAGCCAGCAGCGTTGGTACCAAACGACCCCGCTTGCCGCCCAACCATCTCCCACAGCAAAGCGAGTGCGCGTAGACTCCGCTACCGGTACCCAGCC
ACGCTCCCCGGAGGACGTAGCGGTTCGCGAATTAAGTCGCATTGCCTCGGAGATCCGCACCGACCTGCTAGCTTGCATCACTGCGCGTGTGACGGGCTTT
TTACGCGTGCACCGCGACCAGACTGgaccagcacgtgaagcCGATGCTGACGCTGTGGCTGAAGCTGTCGGCTCCGACATCCGCCAGAAGCTCGCACAGC
TGCAGGCCTCAACGACTCCGTCGGACCCGATGCTCTTAGACACGGAGACCACTTGCATGTACCGCGTGGAGATTCTCAAATTCATCTCCCGCGAATTGCC
GCGTGCCG