Description :
From Genome Similarity Track
Location :
Scaffold_2839:363- 2745
Sequence
2382 bases(100 bases per row)
CTCTTCGGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCG
TGTGGCACTGTGTTATCCACACAGGAAGCGTATCCGACGTCTTCCGCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACA
CGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGC
GGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGG
GTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGAACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGT
GCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAG
ATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCGCAAAGCTTCGGACAACTTC
TTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGGTGATCGTACCCCCGTACACATCCGT
GTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACG
AAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGG
GCTTGGGGAAGGACCGTCTGCGGAGTCTTTTCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGC
GGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGA
TGGCTGTATTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGTTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGT
CCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGTCT
TCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTG
AAACATCCAGGGGATGTCGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGA
TCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCACATGGCTTTACCTTCAGCCGTATTGGCTT
CGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCG
AGCTGCTCAGCCGGTGTTGACACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCAAAT
GGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGG
TCACACAGCACCTTGCGCAAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTTATTAAAGAGAGCGAA
GTGACCCAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAAATTAAGTTTGGGTTTAATACAAACTGTTAGTTACTTATGGAAATGCAATGTCAT
TTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCTCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGT
AACCAGGGTACACTTAGGGCTACGTACCCCGTTACAAAACCGCACTGTCAAATAATAAAAACTGACTGAGTTATGGGCACTC