Description :
From Genome Similarity Track
Location :
Scaffold_1420:363- 1429
Transcript NameFunction/comments
g11360.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
ACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAG
TGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGAAT
GCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAATGGAACGCGTCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACC
ATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTTTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTAAGACGCA
GGCAGTTTCCTATCCAGACTGCATTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTC
CCACGGTCAGCTGTATGTGGCCATGTCGAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGATCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTAC
ACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGAGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCGGTTTGCATA
GCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAA
ACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCC
TGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGACT
TAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCG