Description :
From Genome Similarity Track
Location :
Scaffold_2:36290- 45310
Transcript NameFunction/comments
Phyci_88948Hypothetical protein
Phyci_88950conserved hypothetical protein
Phyci_100285conserved hypothetical protein
Phyci_297904lectin putative

Sequence
9020 bases(100 bases per row)
AGAAACACGCGAGGACCAGGATCAGCATTTTAGGCTTTTCTTGCCTTTCCTCGAACACAGCCGAAGATGCGCATGTAAAGATGTCCGAGCGCGTTTCTAG
TTTCGGTGTCGTTGAGCGTCTTGGATCACTTCGAGTGGGTACCCTCGGTAAAGGTGGCCGGTGCATTTAGACGCAGCGAGCTCCCCGATTTACGATGTTG
TGCAGCTCCCGAATCGCGATACCGCGAACAGCTGGAACAGCGGCGACAGACCAGTGTATCTGGGACCATTTCGGTGTGCTTGAAGCGATGTATCCCGGTA
CCTGTACTTGGCACCGTGCTTGAATGCTTGCGTCGGCCCGGCATGGTGCCGTGCGCTACGGTAATGTGGGCTCGCAGCAAATGCAGCTACCTGTATGTAA
GAAGTCGAGCCTTTGGGTGACGTCCGGGGTCAAGGTGACGAAGGGATTGCGATTTGTGTTCGCTTTCGAGTGCCCGTCACCGCCACAACGATAACAAACA
AACTGTGGTTTGGCCACTTTCTCATCATTGCTAACAAGTATTAGAATACACCGAGCACAGCGTCATAGTTCACTGAAACAAGGCGAGCTGACAGGTTGGA
GAACTCATTGATCTATTTGTTCAGCTGGCACTTAAAACATCGCTTAGTTCATCCTGCTACGCAGCGCAAAGGGCAGTGGTGAGTACAGCTAAACAAAGCC
ATAGCTTTAAAGTTACGCGAACTTATGCGATCTTACCTTAAGAGGGCTGCGGCTTCTTGGACGGTTGGGTAATCTTTTATCCTGTGTAGGAGGTAACCAG
AATCCAACACTCGGTTCACGCAGTGGGTAGCGGTAAGTCTGAGTAGATATCCGTCGGCTGCTGGTCTCCGAATAGTTCCCTGGCGACGGGTAACTCTCTG
CACAAGATGACAGACCAGGGTCAAACCCGACCTGTTCAGTGGTACATAAGCAGCTTTGCTCGTCATCGCCCTCGACTTCTTCATCATCTTGAAGAGTGAG
CTCGTGGATCGTAAGGGCTTGCTCTTCAAGACGCTTCATCAGCTTCTGACGCTCCAACTGCAAGGTTTTAACTTCACGCAGGAGCTCGTCTTCCTTCGTA
TCATTGTTGCCCTGCCATGAAGTCCTGTCATCTCGAAGCCTGGCCTTTAGTCGAGCCACCTCTTCTCGCAGGGCCTCGCATTCCTGGCGCAAGGCAGCAA
TAAGACTAGTGAACTCGGCGGGCGAGGTAAAATCACCCCCTGCACCAGTTGACGACAAGGCGGACGAGTCGATGTGAATATGATTTGGTGACGGCTTTGG
CTTTGTTGGGGAGACGTAAGTGCCGTCGGCTTTTGCTTGCAGTAAGTCGTCTATTGTGTGAGCCTGTTCCTGCAGGAACATCGACAGACGGTATGAGTTT
CCCGTTCACTTGTGTTTATATTGCTTGGCATTCGAAGCTTACCTCGATCAAAAGGTTGGCACTCAATTGTGCCTCGACAATTTCGTTCCAGTGCTTCGAT
TTTTCCTGCTTGAGAAGCTCGTATTGTGCCAAAAACTCATCATATCGCTGTGTCAACTGTTCATGATCTTGTGCAATGGACTGCTTATCGGACTCAAGAG
TACGGATTTGTTCCGTCATAGTTTCGCGCTGCACAAACCACAATAAACTTAGTTGGATCGCAAACTAATGCCCCCGCTGCATTTCACACACACCGTACCT
CCTCGAGACGAGCGGTTTCGAGCTCCTGAAGTTTTTTGCTTTGGTCTGCTGTCTGTATTTGCGTCAAATCCACTTAAGTTCTACAGCAGACACATCAGCA
GCCGAAATCAACTACGTACCACAGCAGTCAAACTCGTTAAATTTTCAACCAAGTCTTGCATCGTCTTCTTCGTTCCTTCCATTTGCTGGGTCTCTTCATC
TCTCTTAGAACTCATTTCCCGTAGTTTGGTTTGAGTTTCTTTTAGCAGGCTAGACAACCTTTGCTCCGTGTCTAGCAGTTCTTGGTGTTGGTTAGTCACA
GTTTTATATTTTCCACGCAGGACCTCGTTTTCCTCGATAGCAGTTTGCAGTTGTTTGCACGTATCCAAGTACTTCGAATTTACTTCTTGAAAACGGTCCC
AGCGCTCAAGCTCCAAGTTCTTTGTAACTTCAAGTCGTGTTTGCTCCCGGACCACATCTAGCTTGAGTTCCTCGTCCTGTTGTTTCTGCTCTGGGGTCTT
CAAGCACTGTTGACAAGTAGCGCTGATCTTCTTGTGCTTCTTCTCAATATCCCAACACTCCTGCTCCTTGATTTTCATCGCTTGCTCGTGCCGCGTCTTC
AATTGCTTCATCGCTTGGTATATTTGCTCATTCTGTTGTTCAATGCATGTTCGCGATCGGAATAAACCGTTGTAATCTTCTTGCAGCATCATAAGTTGTT
CTTTTGAATGCTGATGGTTACGCAGCACTTCACGCCACTTGTCCTTCATGTGCCCCACCATCAGCGAGTGTTCAGCTTTGAGTTCACTCTTCCCGTGCAG
TGCCTCTTGTAGCGCAGTTGACAAATCGGCGACCTTCCGTTTATACACAGTCACCTCGCCTCCCATTTTTTCCTTCAACTGAAAGCTGGACCGTTCTCGA
TAGCGTGCATCCTGCAGTTCCTTGTCCACTAGCTGCAATCGCGTCTTACACTTTTGCAATTCATCCGCCATGGGTCGGTGCACATTCTGCCACTCTTTTC
GCTCGCTTTCCAGTTTGCCTCTTAATTGCTCCACCCTCGCCCTTAACGCTTGACGCTCCTCTTGGGTAGCACGTACATTTGCTGCTGCCTCGTTCTTCAC
TAGATCCACCGTCTCGTCGTGTTTTTTCTCGAGCGTGCGCAGCTTCTCGTTAAGGCGGCTCAGCTTCGTTTGGTCCTCTTGTCGCTGATCTAGTGCCGTC
TCGAGCAATGAGCTCGTATGTGTGAACTGCTCCTGGAACTTCGTTCGTTCAGCTTCTAAAGCTGTCATGGCCGCCTGTAACGAAGCGATCTCGCGCTTGA
GCTGAATCGTGTGGGTACTAGCAGCAGCGGCCGCGCGGGCGGCTGTCTGGTCCTTCTTGATCAGTTGTTGCCGCAGAGTTTCGAGATCACGCAAGAACGA
CCGACGCTCCTGCAGGTTGGCGAAACGACGTTAGCGCTTGCAAATGGCTACATTTTTCGTCTACATCTTCAACATCCTGATGCAAAGCAGAGAGAGACTT
GATACCTTGTCGAAGCACCGCTGCGCGTCCTTCAAGGAGAGCGTGGAGGCCGCGATCATGGCTTCCTTCGCCATGTTCAACGGATGGGGTGGCACGTAGC
GCCCTGCACAGCGTAGGTTTACACCGCAGCAGCAAAGGCTAATCTTGGCGCGAGTTGGTACGAACTACTTAGCGAATCCTATTAATACTTACGCTTTTTA
AATATATATAATCTAATCGAGTTTTTCTTTCCAGAACGACTTCAAAACTCGATATACCTGTTAGTCTTGATTCGACCGTTTTTGGTCGGTTTTGAAACGA
TGAGTGATGTGGCGCACACAAAGCTTTGAAGTACATCGTCGATTTGGGTATCCGTCGACACTTGGAATTGCAGGAGCCCCCCCCCCTCCGAACCAATGGG
ACTGCGTCTGCGCCAGCTCCAGGTGCTGCACCGCCACGGCGATCGCACCCCTCTGCATAATATTTTCCGAGGAAGCGTCAATGCTCGCCCCATAGAAGAG
GAGGTGCAGCTGTGGAGTCGCCAACTCCCGACAGCAACGCAACTTGCGCAGCTCCGTTCCAAGTTCAGTGTCCACTTGGACGGCGGCGTTAAAACTGCGT
TCCAACAGCGGCCATTTGGGTATTTGACCACGAGAGGTATCGAGCAGATGACAAAGCGTGGAAATCGGCTGGTGAGGTGCAGGATAACTTGGAAGGACTC
CATATCGGTTCCAGAGACTCACGAAGGATCGTGATATGTAGCGAGCATTCTGCCAGCGAGAGGAGTTGGACCTTGGTGAAGTGACACATGAGCAGGTGCA
GATCTTCAGCAATTCCTACACTCGCACTCAATTGAGTGTACAGGCGTTGCTTGGTGGTATGCTGCGTGATCAGCCCCAGTTGAGTCCTCCGGTGAGTGTT
CTTCCTCCGGAGAAAGACATCATCAACAGTGAGCACTTAGCAGTTGATTGGATCAGCATTTGGCAAAGTGCTGACAAACGGGTTCGTGTGAACTGTTACA
CATAGCGTACGGAGTTTTCCCAGAGATTATGGAGATGAAAACGGACTTGGAGCGGGACAACGAGGAATTTGCGGCGCGCGAGCACGATATGGCACCCGTC
AAGCAAGAATTGATGAGGTTGTTTCCAGCTGTTGACTCGGGACAGATTCCCTTTTCCTGGCTGACCGCGGCCGACTACTTCGTCTGCCGTCGCGCTCACC
AGGCCCCCTACATTCCTGGAAGTGAAGTCCATGGTGATGCTGCTGAAAGACACCTCGGTTTCCGTTTCCACCAGGTATGAGTGCCATTGGGGTAGTGCAA
CGGTCACCTTGCAAGTTCTGATCCGATATGTTGTGGTTTCTGAAGTTTTACTCTCATCGAACGATTTTGAAGCTGGTTGCCGGTCGCCTAATGCACAACG
TTCTTCGTGAGGTGGGGCCGATTTATCCGTACAATAAGAGTTGAGCGTGTATGCGATATTGATGTTCTTATTTTTTGGCGATTCAGATGCAAAAAGCTCT
GTGGGAGCACTATGAGAACAAGAAGATCGTGATTTACAGCGGACACGATGTGTCTCTACTGTCGGTTCTCCGGACCGTGGACGCTGAAATCGCAAACGAC
ATCGCGTGGTGGCCCGAGTACTCCTCGGCTCTTGCGTTAGAGCTACTGGAAAACGAAGACGGGAAGTTCTTCGTTCGTGTTCGACTGAACGGCGAAATCC
TTGCCATTGGTGATGCCACCGATGGCCTTTGCCCCCCTGACCGCTTCCGTGACATGGTGTTGGATCACATCGGAAGCCGCGCTGACTAGGTGCATATCAG
CAGGTACCAGTTTGTGAGTGCTCAACGAGCAGAACCAAACAAAACTTACGCCAATTACACAAGAGAAATAGGCATTTTGTTTAGAGCAAAACTAGGCCAG
AAGCTCCGCCACTTGCAGCGCACGTTTGTAGCGTCGGCGGGCGAGCTTAATACTGAGCATTTTTTCCTTCTCCTCAGCCGCGGCCTCTTCCTCATCTTTA
GCTGGAACTCCAGCGTCGATAATTTCTTGCGCTGATTCCATGACACGCTGCGAAAACACACAGGTTCAGCAAACAATACTCCTCCTGGCAGCATTTAACT
CATGCATCAGTACTCACCGTGCGAGCAGCGCCCTGAATACCGTTAAGGTATTCCAGCACAATAGCGAACATGGCCTTGGGTACGACGTCTGCCTCGTACA
TCCACTGCAGGATCCACTGCTGTTTAATTTTCTGCATCGCCAGACACACAATGACACAAAAGTTCAGCGGACGCCCTACTCGTCCTATGCAGCACCCGCT
AATTGAATGCCGAAAGAAGTGCACGTCCTCCCAACAAACCTTAAATTTCCAGGGAAGTTCGTCATCAGCCTTGGGCTCGTCGCGCTTCTGCCACTGCTCC
AGGTAGTATTTGGCCTGCTGGATCATCTCCGGGGAGCGGTCCGACTTGCCACCGCCCTCCTTCTCCTCCTCGGCGTCCTTCTTCTTAACTGCACGCGCGC
GTTTCTTGGGCACGACCTTGTCTCCATTGTCGTCGAACTTTACGTGGGTCTTGGCCCCTTCCTTCTTGTTCTTGGCGGCCTTCAGCTTGCCGCGCTGCTT
CTTGGACGGCTTGGCGGCGCCCATGGTGATCTAATGACCTCCTTGCTGCACAAATGAACGTGTCTGCCAACCAAATTCCTGCGACGTGTGTGAATGATGT
TGTTCACACTAAATTAGGCGTGGTCGCGGATTGGCGGAATTGCATCTGTGCGATTTGTGATTGGCGGATAAATCTGCCCTCTGGTTCGAAAAACCCGCGG
AAAATCGTAACGACTGTGTCGTAGCTCGCGCCAAAAATCGTCAATGCGCTGCTTGATGTAGACGCACCAGTTCCCTTCTTGCGAGCGAACGGGCAGCTTT
CGGCCCCCGTCCCTTAATCATCCCGACTGCCTCGGTCTGCGTCTGAATGCCCACTGCACGTCTCTAGAGTTTCAGCTGCGGTCGTGTGCTCCTCCCTCCA
GAAATGTGCATCAATCGTAAACGACCGCGCGGTGAACAGCTACGCAGTCCGCCTCCGACGCCCCAGCAGCTCCAGGCCGACAATAATCAATTGAAGCGTG
TCAAAACGGAGTCTCCCACGTCTGTAGACCGCTTTGGAATTGCAGACAACCAGATGGAGGAGAAAGAGGAGATCGCGACGACCGCGCATCGTGACGAGAT
GGTGGCCGCCATTCTGACCATCACGTCAGCGCTGGGCCTCTCAAGAGAGACGCTGCACCTGTGCGTGGGCCTTCTGGACCGATACATGGAGCAGCAGAGC
ATCGAAGTAGCGAAATTCGAAGCGCTGAGCATTTCGTAAGCATTGTTGTTATTGTGTGAAGTGATTGAGGATCGCCGTATTCTAATGTATTTGGCTCGTT
TTGAATGCAACGATAGGTGCTTATGGATCGCTGTGAAGTTCATAGAGACGCCCACGACTATCTTTGACAAGAGCATTAAAGAGATTCTGCAGCGGCGAAG
ACTTTCCAGCAGCGTAAGTTGCGAGGAATAAGTGTGCTGTTATAGACTGTTTAAGCTTGACTTACGGTTGTGTTAATTATGCTTGCTCACAGTGGACGTG
GAACGAGATTCTCGAGTTCGAGCTGAAGATCTTGCATATTTTGAATTTTCGGATCATGGCCCCCACGATACTCGACGTGCTGCAAAGAAAAATCTACGTT
TTTCAAGAAGACAACCAAGGACACGAAATGGATGCCCTTCCATTCGAACAGTGCCAACTTGCTCTGTATTTTGCAGACCTACTGCTGCTGAAGGCAAGAT
CCAACCAGTTTTCCAAGAAGCTGCTTGCGGATGCTGTTTGGTTCGTGGTGTCTGGAAACCAAATTTCGGACGTAAAACCGCCGCTATTGGAACCTGTTGT
GCAGCTCTATCTAACGCACCGTGACAACATCAATCCACGCCACGCGGTATTCAAACCATGGTTTGCGCTGCGCTGCCGCTACGGTGCTTTCCTGCCTTCG
CCATGGAAGGTCCCCTACGACCCCTCCTGTGTATGCCGTGTCTGTGAGCACGTCAAAGACGACCTGACATCGTAAGGCTCGATTCCACTGCCCCCGCTCA
CATTTCGATGTAAACTGTAGACATACAAAATAGATGTACCATACCCATTGCCTCACCTCTACTGACAACAACATGTAGTGCAATCGGATCAACCACCATG
ATAAATGAGAGCACGATAATGACGTGTGTATCTCTACAACGATTACAAATGACCAGTTCAGAAAACATGAAACGAGTTACCATTTGACCCCAAGCTGATT
TCATCTCCTGTCTGTGCCTGCACCTTGCCATCTCTAATGTGCCTGGCCGACGGTGTCTGACACCAGTGCAAGTTAAAAGGGATGAATCAAACCGTCTACA
GGAAGTGCGTCTTGCGAAGGTCCTGGTACTTCTTGTAACCAGCGGCCACAATGCCAGCGACGATGAACAGAATGACAAAGAACGGGGTCTTCCAGCTACT
GGACTTGGCTGCCGTTTCCTTCACGGTCTCTTCAAGCTGCGTCTCCACCTGGTCGCGGATGGCATTCACGGTGGTGTGCACACGCTCAACCACCTTTCCG
TTTGCCCAAGCCTCAAGCTCATCAATACGCTTCTCGTCCTCGACACCCTGCTGCTTCAGCTTCTGGATGGTGTTTTCTGTCGACTCCTTCAGAGCTGTGA
ACTGGTACTCGAAGTCCTCAAGCAGCTGAGAGTATTTCCGCTTGACCAGCTTCATCTTGTCATCGTTGTTGCCCTTGCTCAACGTGGCCTCGAGATTCTT
GTCCACAGCATCGCGCTGCTTCTCATCGGCCTGGGCCGCGAGCGAGTCAATGACATCACTGAATGCATCAAAGAAAAATCGTCAGCTCTACAAAAATAAA
AAAGATGCACCCAAGCCAACGTACTCGTAGACGTTGAGAGCGATGACATCGTGGTTGTCAGCCAGACCGCCAGTGGAGGCCGAGATGCCGAAGTACGCGT
CGTTCATCCAGTCGTCACCGATGGTCAGACGCTGGCCGTAGCACCTGACCCAGTTGCCCGAAGCGTCAGCGTCAATCAGAATCGTGAGCTGCTGGTCCGC
CTGCGTGTACGTGATCTTGGCACGGGACATGTTGAGCGATGGGCTGAAGGCCGCGTTCTTCTCGTGGGAGCGGATGCCGGGAGCCATGCAGCCGACCTTG
TCCATGTCGTTGAGGTGGTCGAGCGTCTTGGACCCGTCGTTCTCGAAGAACGTCACGTCCTGGTGGCCGCCGCTGTGCTCCTGGTTGACGAACGTGTCGA
ACACGACGCCGACGCCCTTGAACCCTCCGATGAAGCCGTGGTTGTCGCCCTGCACGTACGGGCTGGTCGTGAGCCAGAGCGCCAGGCCGTCGCCGAACCA
GGCCTTGGCCTGGCCGCTGATGCGGAACGTGAACACGGCGGCGAACTCCTTGGCCGCCAGCTTCTGCTTGCCCCAGATATGGCCGCGCTTGCTCTGGCGG
TCGGGCGTCAGGCGCGCGAAGTGGCGGTTCACGGCCGTGTCGCCGCCGTACACGAAGTTGTCGCCGACCTGGCGCAGGCCCTCGCCGTCGATGTTGTCGA
ACGGCTTCTCGAAGGACACCTGCTCCAGCCGCTTGGCGCTGGCGGGGGCGTTCTGCAGCGCGGCGAGCAGCGTCGCCACGCACAGCAGCAGCACGCGAGA
GACGCTCATGGTCGACGGTGCGCGAGGAGGAAGGAGCGGAATTGGCGTCTGCCCGATTCGCTACGTGGCGATGATCCGGACCAGACTGGGGAGTACTGAT
GATGCTAGGCTAAGTACGAA