Description :
From Genome Similarity Track
Location :
Scaffold_424:3629- 6961
Transcript NameFunction/comments
Phyke_g9394hypothetical protein PHYSODRAFT_564254
Phyke_g9395hypothetical protein PHYSODRAFT_523131

Sequence
3332 bases(100 bases per row)
TTGTGGGgcgtagtgctgctgcccgGCACGGGAGAGCATGGATTTTTACATCGGAGGACATCCATTGCGATCCCACTTTCGAAACAAGGAGTCGCTACTT
TGGTTCGTTGAGTGAACTAAAAAGACATAGCACTTGGTGGTTGATTCTTGACGCTTTGTGTGTATTTTATCTTTGTAGATCCTGGAAGGACCTTTCTACG
GGAAGCGCAAGCCTAGTCTACAAAAAGGTTCCAAACTGCGGAGGTGTGTGATCTCATGAGGCATTTTTGTGGTGCTTAGACAGAGGTTTGAGTTTTTTTT
ATGATGCTGTGTCCACAGGGTGAGTGATCTACCAATTCTTGGACAAGCTACAATTGAAGAGGCAAAGTCTTTGTTGGAGTATTTCCGGGACCACCACGGC
TTCTCGCAGCTTGTGGTCGCAGGGAGTAGCATGGGAGGACTGCATGCTGCCATGGTCGCGTCGGTTTTTCCAGGAGATGTGGGCGCTACAGCTTGGCTGG
CGCCGCCCTCAGCTGTCCCCGTTTTTGCTGATGGATTACTCTCAGCGTCCTGCAATTGGCGCTCGCTTTATAAACaacacgagctgcagatgttggATAA
GATGTTggctggaagtgctgctgcatcatcataTGAGAAATTTGACGCCGGTGCTACTCAAGCTGATACATTTGAGAGCCTGGAATCTAGCGACGCGAAA
GTGGACCCAGTCCAggaagccaagaagcgcatgaGACTATTTCTCTCCATTACAGATATCGACAACTTTTTGCCGCCTCGACGCTCAGACGCCGTCGTAT
TCGTCGTGGGCACTGAGGACGAGTATATTGGCTTCACCGAGCCACAGTGGGCGGTAGTTTTGCTCTCATTTTATCTACCAAAATGCTGTTGCGTATTGGG
TTTTCTTACGCACATGTATATTGTTTACTATTTTCTGACATTTTATCCAGCGCTTACGCAAGCAGTGGACGCCAGCGCACTTCCGGACTATCAAGACGGG
TCACGTAAGTGGCATTttgctggaacaagaagccTATCGCAAAACAATCCTGGAGGTTGCCGATTTGTTGAAGGAACGCCAAGTGTCACCTGAATCCTCC
GCACctaaagctgctgtcgtcgctgcttgaaTTGCCCTTTAAAGCATCAGCCACAATTTTAAAACGAACGCACATAATTTTGTCCCCCCACGCGCGTGCT
AGCTGGGCTGTGACTGAAGGATAGGTCCAGAGTAACTCGGTTCGAGCGTGTGAAGCTTGACTACGGAGATCATTGCATCAAACCATAATTTTCTCCCATA
TCTGGGCCTGTTGCGAATTTACCTGTATTTGCATTACTCGTGTAGACAGCAAACGATAATGTCCTGATATGTGCTCATGACAGTTCGCAACTCACCGCGC
GAGAGATTTTCGCGCCACATGATCTCTTCGATGTGATGCTCTCCATGGAAATATACACATAGTCTTTTAAAGAGCGTGAACACCGGGTTGGGCTTGGCAA
TCTTGGCGAGATACGCACGCTCCTGATCCGTGAATAGCAATTGGCTAGCCACACTCATTACCTGTGCCATCGGTACGCCACTGCCATTGCGCCCTTCTGT
CATTGTATCATCTTCGGATGGGTCCAAAGGCGCCGTTGGTGGCGAGGACATCGCCATAGTCGCGGGGTTCATTGGTGGCGTGGGTGGGACCGGCACACTA
CCTGTGGCGCTTGTGTTGGTAATACTACTGTTAACTCGCTGCCGCCGAAAACTGGAGGCTAACAGCGCCGGTGAGGAACTGCCAATCGAAGACGAGATAC
CACCATTGCCAAGTTCAGCGGCGTAGTCCCCATCGGACGGGATCATAAAATAGATGTAGcgatggagctggacgatgaagcgctgctgcagtagccAGAT
CAGCATGTGGATGTACTCggtcttcttggccgtgGATAATGTTTTCATGTATTCACCAATGCGCCGCGAGCCAGAAAATGTCGACAATACCTCTCCTAGT
TCATACGGCGCGAACTTTCGTCGGAACTCAACAGCCAGAGGTGCTGTGATGTGTAGATTGGCCTTCGAATTGACCTGGTAAATGTTGTAAAGCGTGATCG
CGTCTACGATGCGCCCAAAACCCCAATAGGCTAGATGTGCTGCCAGACGAAAAACTTGATGAATCGGCACTCCAGTCTCAAGTGCTAGATCCTGAAAGCT
CTTGAGTGGGTTCACAGCCTCCACAAGATCCCGCAGCTGGCGTGCATGGTCTGCAGGTAGCTTATTGATGATGTCCTCTTTGTCAGTGAGTAGTAGCAAC
GTGTGATATGGCCGCAAGCTGGGCATCCTCACCGACACGGCGTCTGTCAGCGTCAGCGACAACTTGACCCAACGATTCAGCACGACGTGAACAGCTCCGT
CCTCTTCCAATCCATGGAAAACTCGTTTCAGATCATTAGCCAGCACGCTTTTGCCCAGTGATACGTCAATGAGGGTCTGCGGATCCACTTCCACAGACGT
GGATCCATCACCGTCCTTCCGAttgtgatggtggtgcaTCAAACTCGATCCACtcgttccagctcctcctcctcctaCATTACTGGTAATACTGCTTCCA
CTCGTCGCAccaactgcaacagcagcactgaTACTGTTCCCGTTGTTAGCAACCGCCACTCCTGATTTATTGTTCGCGTTGCGTTCACTCTGAGCCAATT
CGTCCCTCAACTGAAGCAACTCCCGCACCTCCCTCGACACGAACCCAACCCTTAATTCCTCATGTAACATCCCATTGGCGAGTTGTGCCGCCACTGTATG
GAAAGCTTGGgcgctgtttcttctccttgcAAGAAGTTCATCTTCGTTCGCTTGTTGCAAAGGCAGCATCTGAGTGTCTATCACGGACGTCGTGGCTGTC
ACCTGTGGAGGACGATCCTCTAATGCAAATATGATATTAAACATGGTCGTTTCATTGCCCGACGGCGTTGCAGAGCCATTCCCGGTAGAATTTGTGGTCA
ACGTTTCAGTGGTCGACCCTTGTCCTGTAGCTGTTGAGGTACCATTCCCAGTCGTAGAAGCTGCGTTGGAGAAACCTGATGGTCCATCTGcgggtgcagc
agctgggAGACGTCGGGAAACCAGAACTGGATGACTTACGAAGCGTAGATCATCCACCACGAGCTCAAAGCTGGAGTTGCAGAGCGCGTTTTTAGGGCGG
AAGAGTTTGGCCAATAGTGGTGCAGGGAGCGTGTGGAAATTCGAGCCATTTTcagaagacggagctggGTAACGGAAGGCTAAGTTGCAGCCTTTACTGA
TGTCGTCGACAACGAGAGCCACGCCTAAAAGG