Description :
From Genome Similarity Track
Location :
Scaffold_316:3629- 4727
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.16Myosin

Sequence
1098 bases(100 bases per row)
CAACACGTCTTGGTTGTCCGCGTATTCGATGTGGTTCCACGTAATACCTTCTTCTTCATATTCGATTTGCACCGTCTTGAACACATCTTGCGTGAACTTC
TGCTGCAGCTTTTCATTGGCGTAGTTGATGCAGAACTGTTCGAACGAGTTGTGCTTGAAGTGTTCAAAACCGAAGATATCCAACACACCAACGTGGTTGA
ACATGTTATTGTCATCGGAAAGCGACTGGTTGATCGACGCCACGAGCCAATCAAAGACGTTGGAATAAATAGCTTTCGCGAGCGCGTCACGACAGTCCAT
CGCTTGCTCCTTGCGCAATGGCACACTGTACACATCGTTCACTGCGCGCATCGTACGCGAACAAAGTGCTTTCTGAATCGCTTCCCAGGAAACACCGAGC
AATTGCGTGGCCGCGGTCGCGCCGGCATCTCCTTCGGCAATCAAAGACTCTTCGTCATTCGCTGGGTTCGACAGCAAGCTGATCTCACCGAGTTGCAACA
CACCCGCCAAGACTTCAAAGAGCGGCTTCTGAGCGTCTGGAGTAAGACCGATCAGCTCCAACGCAACGCGCGTCTTCTCAAAGTGCTTCGCATCCGACAC
GCCCTCGATCTTTTGAGCGCTGTTGTTACCAGTGTACGCGTACGTCTTGGACGGGTCCAACAGAAACTCTGCAGAACTGTCTCCTTCCAAGATCTAAAGC
AAAACAGATGCAAGAAAAAAACGACAGCGAAGTTAGTGCAACCTGAAACTCGTAATGATAACAAGAGAAGTATAATATGCGTACCTGGTAGAAAATGTGG
TAGTTTCTCTCGGGGGCTTCATGGTTGATCACACGCGTCTTTTCCAAAAGGTACGTGCGGCATTTGGCACCCACCAGTGTTCCATCGCGATCAAACTGCA
ATTGCGTGAACTTGCCGAATCGAGAACTGTTGTCGTTACGCACCGTCTTGGCGTTACCAAAAGATTCCAACAGAGGATTCACTTCAATAATCTTCTTAAT
GGTCGAGTTGTTCAAACCACCGGCGATCGTCGCCAAGTGGTTCATCAGAATCTTGGTCGTCTCCGTTTTACCGGCACCAGATTCACCACTGACCAAGA