Description :
From Genome Similarity Track
Location :
Scaffold_1743:3628- 7129
Transcript NameFunction/comments
Phypl_g14060hypothetical protein

Sequence
3501 bases(100 bases per row)
GAGGAGACTTTCGGAATGGAGAGTGAACGTGGCCTTTGGAAGATTTGTGAATATAAAGTGTTGAGACTCAAGTATGAGTGCCGGAGTCTGGATGAGTGAA
ATGATGAGAACGACGGCGTGATTTTGGATTGTGAAGTGCATTCTGAACGTTAAACGGAAACTACACATGCAAACATGGAGGACTAACAACGTTCCGAAGG
CACGCCCGACACGAAGTCAGGACGACGACCGCTCAGAAGATCTCTGAAATGAGGTCACGATGACCGGTCGGGATCATCCGGCCACGGACGTCCTGTGGAA
GGTGCGCCACACGCTCTTTATCCAAAGCGCAGTAGACCCACTAAAGCCGCGCTGGCTCGGACCGGTCCAGGATTTCCAACTGCTTCCGCAAGGTGTAGCG
CCGCTTGGGATTCGTGCTGGGTTTGTAGTGTCTCAAGTCCATCGGGATCCAGTAGCACAGCTTGTCCGGAAATTTCCTAACGCCAACCTCCCACTCGAAC
AGCGATTCCGGGACGCCTTTTTTGATCAGGCGCTTTGTCAGAGCGACGAATTTATTTTTGGCGTTGTCGTGACGTCTGGCGCGCCGAGTGTGCATGCTGA
TCAGCATGTTCACAACGTCATCCGGAAGCTGGTCCGACTCGAGCTGGAAAATCATCCAGTGCAGGGCCTCCCAGACGACACGTGAATTGGCGACCAAGAA
CTACAACCACTCGTCCAGACCGTCCAGTTGGCGCTGAGTGAGTTCGGAACGCCGGTGGAAGAACAACTCCTTCGGACGATCCTCCCACATGTTGTTCTAT
GGCGATCCCGAAATCGTGATTTCCTTGTACTCTGGGTAAAGCTCAATAAATCTGTCTTTCAGAATTCCAAAGTCGCAACGATTCGGGACGCAGTTTGGAA
AGCCGAGGGTCTGTGTGGAAGAGCGAGCCGTCGAGTCAGACCTTTTTACTCGGACCCCGTGGTGCAGCCATGAGCGAATATCTTCATCTCCTAGAACTTC
GACGATCTGAAGTTCGTCCTGGGTCAGGTCCTCGACCAGTTTCAGAGCGAGTGCAGTTGCCTTCTCTTCACCACCTTGTTTGGACCTGGGCAGAGatttg
gagctgcggcggggTGACCCAGTGCGACGTCGTTTGGAGTTGCGTTTGCGCTTGGACGGGGATACTTTCGGCGCCTCCATGTCGatgtcgtcatcgccat
tTGGATCCAGAACGAAGTCAGCATCCTTGGACGTGTCATCGACCTTTTGGAGCGTTTCCTCTTCAACAACATCGTCCTGAATTTCAGGCTGTAAAGGGTC
CCAAAAATCCGGCACTTCATCTGCATCGAGGATGTCGTCCAGACGTACTCGTGCTGCCGCGTAATACCGACTTGGGACGTACTTTGGCCAGAATGAGTCA
TCGAGCTGGTTCCAGAACATCATCCGAATCAGCATGTCCAAGCGAGGTTCCAAATGAAATTCAGAATGCGCGACACGGTCATCATTGAGCCACTGCACAA
CGCCAGTGTTGCCGACCCCTGTACATAACAACAATTGTGTGTCCAAGCGGAGGTCGTCATACACAACAGCGTACCCCGTGAGGGATTTCCGAGCTTCATC
ATCTGAGAACACCAGTAGATCGCCCTCTGAACATCCGAAGTCCTGATCCACTCCGACGGAAATTCTTGAACTTCAGTCGGAATGACGTGTTCTGACTTCT
TCGCAGTCCGTCAGCGCTGTCCGGAGCGAGAATGCTTGGACGAGTCCGAACACGGAGTCGTGGGGGTGGAGTCCTGAGTCAGATCGAAGTCGAGCTGACG
GGCCCGGGTGCCGCTCTCCTTGGattcctcgtcttcgtcgttgtccgGACGACTGATTGGAACGAAGTTTGAAATCGGCACGAACGGGTCTGAGGCGGTC
ACCGAGGTGATGGTGTTCCAGGAACTCGGAACGGGAGAACCATCGCGATAGTGCGTGAGTAAATCCCGAAGTCGTGGCCACTGGAACCTCAACGATGCAT
GTTCGCCCAGGGAATTCATCACCCCGGCGACGTCTGCAGGAGAATTCCGAATCGCCCATTCAGAACGTAACATTGGGACCTTGCGTCCTCGAACTTCCGG
GTCCGCCCGGCAAGTTGAGTCCGAATGCCCTCGACATTCTTGACGTTTCCGGTAAGCAATTGCAGGGCGTCTTCTCGACCACGACGCATGAAAATGTCGA
TCTTCCTCCAGAGGCTGGACCTGACGTTCCCAGTAATCGGCCTGGTACTTGTAGTCGCGCTTGGGttgctccagctcagcacgaagccCGACCGCATCCT
GAACCGCCTGGTCCGAACGAGTGAGCTGTCGAACCATGTTGTCTGAATGTTGGGCCATCTTGCAGAGCATCAAAACCGTTCCAAAAACGCGTTGAGCCAG
TTATGCCGGATAGAATTCCGTGTTGATCGACGCGGCTTCGCGCTGAAGCTCGACggagtgctgctggacatgcAGTTCGTCGTCCTGACGCGGCTTCTCA
CGTGGCGTCAGAACGAAGTCATGGATGTAGTCTCCCTCATCCAAATGGGCGTACATTCGTGCGAGCTGGACCCGACTGGGAGACTCCAGCTGGACGAATG
CCTCCAAACCGCCATAGCCGTTCTGGGTATGAACATGAGCGTTCAGGGGTTCTTCAGTCGCCGGGATTCTCACGGGACGAGTCGCGCCGCTTGGAGAGTG
TTCGGGCGGGACTGTGTAGGGTGCCGGAGCGAGGATCTGGCCGCTACTTCATACTTTTCGAAAATCCGTGATGACACCAGCAGTCTGAAGTTCAGACGCG
TGGTCCTGAGTCGTCACCTTGGATGCCGACTGGCGCGCCAAAATTCCGCCCggctgctcgccgccgccttgcgcttggtCGTCAAACTCCATGTCATCTG
CACATTCCTCttgctcgctctcgtcgcttgagctgcgcggccaCGGAGAAGCCTGTCCCTCGCCGGTGcctcgaccgccgccgccggcagTGTCGCCCCC
AGCCGGGGTGTTGCCTGCCGGGCGCGGCGTCGCCACGGAGCCTGCCTGACCGCCGTTTGGAGCCATGGCGGTGTTAACAAGACGGGAAATTGCGATCTGG
CTGATTTTGGaggttgccgccgccgtttGCCGCTTTCATTTGAAAGATCCGTGAGAAAGTGGAGAGACGGGACGGAGAAAAGAGGCGACCTCCGCCAGTT
GGGCAACCGATCCTTCGTTCGATCGGTGTCTCCGTTTAGACGGCTTGGGAACGTGTTGCCTCATCACAACCTGTCAACTCGGAGGTAAATTCCTCTATGA
GAGCTTATGACGAGGGGTACGGTTGACACGTGGCGGCTGGTTCCCAAAAGTACCAGCGCCTTGTACCAACATCTTTCGGAGCCCTTTACGGATGATTGGT
CAAGAAgtcttgttggtggtggagaaagtCACCCGTGGAGCCTGTGAAAGACCAAGAGTGATTGGGGAGTTTGAAGTCCGTACGGCGTTCTGGCTCAGAC
A