Description :
From Genome Similarity Track
Location :
Scaffold_13:362795- 369248
Transcript NameFunction/comments
Physo_531594PREDICTED: switch-associated protein 70-like
Physo_417974TonB receptor activity
Physo_290641Hypothetical protein

Sequence
6453 bases(100 bases per row)
GTCGGCCGGCCGCCTCGACGGCCTCCGTGGCCTGCTGCACGGCGCGACTGTGCCGCTGCGCGTCCTTCAGCAGCTCAGCCTGCACCTCGTTGATCTCGTC
CTGAGCCAGGCGGTCCGGTTCTTTGAGCGCGTGCTGCAGGGCCTCGAGCCACACCTGCTGCGTCTCCCTCGAGTCGGCGCGACATTGGAGCGTGCCGCCG
CCGTCCGCGTCCAGGAACTTGAGCACGATGTGCGGCGGGTGCGCGGCGTCCGAGGACGGCGTGCCCGGCATGATGCGGAAGTCCACGACCTCCAGCACGC
GCTTGGGCACAGCCCCGGAGCGCTGCGCCTCGTCCTGAGTGACGAAGAAGGACAGCATTGTGCCCTTGAGCACGGCGTAGTGGCGCTTCCTGCAGGCGGA
CAGGAAACAGTGGGGCCACATGCAATGAGGGACAAGGAGACGGACGCGCCCCGGTGGTTCAGTTGTGCACGTACATGCTGGGCACCTTGCGGCCCTTCTT
CCAGAGGTAGCCCTCCATCGCGGCCAGCTTGCAGCACTACGAATCGTAGTACGATGCCCAAAGGATCCGATATGTTAGTTGAACAGGCGTGAGGTTCTAA
GGTCGCGATCCTGGAGCGGCCGTTATACTTCAACTACTAGTTTTTAGGCTCCGCAGGACCACCATGCCATGCCCATGATCGGCTCGTGACGTTGCGGATG
ACAGCACAGCATATCCTAGATCTACATCATGCACCCGTTGTAACTAATAACAGGATGCGTGTTGCTCGCCGCCCGCTGGTCGATGCACTTCAACTTGTTG
TGGGTCACCCGCACCAAGAGCGAGGATTTGACGGTCTCTGATACCGCCTGGCGCCGCTGGTCTCTGTGGTCGACGCGCACCCGCGTGTTGGCAATTATCA
CGCGCTCCCACGTCAGCACCTGGCATTCTCGAGAGTCTCGCCATCAAATGTTCCCTTTATGCTAAAATGATGTTGTTCAGCAACCTTAACACGGATGTGG
CGACCGTGGGCAGTGTTAGTAAGAACCCATGAAGGTGCAGCAATTTACTGAATAATTTACTGCGTCAGCACCGGGTCTTCAGATATTTATTTCTTCTCTT
CTTGGTATGCAAACAAATACGTATTTCGTTAACTTGAGAAAATAGATATATATCGTATTTTCGGCATGCCTGCTCGAGACCCGCCAGACGCCCAGCGTTG
ATGCCTTGACCTGCGCAGCGTCCAGCTGCCTGGAGTGGGGCAACTTCGCTCCAAGGCGCTTGATCCACATTGAAAGAGTGGTAGGCCAGCGCGAGCGTTT
GCTAGAGAGCGCGTCACTTGGGGAGGGATTGTTGAGCACGAAAGCACTGTCCTTACCGCGCGCTCGGGTGATCGAGGCGACTGAAGTTGCGGCGCTTTGC
TCGTTCAACACCACGAACGCACCTTTGGGCGCGTTGGTCGTGGCCTCTATGCGGAGTTCCAGCTGCGTACTCGCCGCCTTCCAGCAGGCCAGGCCCCCCG
TCAGTTGGTGGGCTACAAGCCAAAGCGCTTGTCAATTGTTAATTGATCACCGTCGCCCCATCGGCCATGAGAAGGATTCGCCACTCGGGTGATCGATTGA
AGCGCTGTTGACTCACGCCTCGGCCCGCCGAGTCTATGAGCGGGCCCTCCTTCTTGGCCAGCCTGGCCCCTGCACGGCCAGGTGGCGCGCGCATTCCAAA
GCGACGAGACGGCCCTCAAGCATTCGTCGCCGGACGACGGGACGAAGCACAGTCGCTCCTTTAGGCTGTTGGCGGAGCTCATGTCGCTCGCGGCCGGGTC
ACGTCAACTTGCACTTTCGAAATTGGCCCGCGACCAGCACAGCGACTCAGGGGCTCATTCATCTACAGGTCGAGCCAACGTCACTTCAGCCACTACTTGA
GTCGGGAAGGAAGGACCATGCAGCCGTGGTCGCCGCCCGAGAACACCATCGTGCTTGCCGACCTGCTGAGACCCTCGGGCTCGCCGCAATCTCCGCACCA
CCAACAGCTCCACAACACGCAGCAGTCGATGATCTATGTCAAGGCAGAGCCCGAGTTCGTGGCCTCTCGACCGGTGCTGCCGCCGCTGCTGCCTCCTCGA
GCGGCGATGCTGCCGGCTATTACTGATGTGCTCCGCTCTAACAGCCCGCAGCACCAGCACTACCACTACGAGAACCAGGAGAACACCAGGGCCATGAGCT
TACCAAGCTACACCCAAGCACCAGCAGTCCGAGAGCAGTACGTGCCTGAGCCTACGACCTTCTCCGCCACGTTCATGAGTACGTGGCGTATGCTTATCGA
AGTTGGTTTCTTAGGCTTACAAGGCAAACACTAACTCAATTGTAGCTCGACCCAACAACACAGACTACCGCAAGCGCAGCGGCCTCGCGCTCCCGAGTCT
TCCCGGCCAGCCTCCATACGCTGCCACGGGAGACATGACACCTCCAGGACTCGTCGGAGCAAGAACCCGGCCCATGACAGACGTCTCGCCAGCACGAGCA
GCAGCGACACCGCGGCCAGCCAACCGCGTCTGCAAGTTCGCAGGCTGCACCCACTACGTCGTGGACCACGGTCTTTGCGTCAGGCACGGGGTGCGTCGCC
GCTCGTTGATGGCCGTCTTCGCGCTGCGTCTTCATCCTTCTAACCTCTTTCAATGTGTATGTAGGGTGGCAAGCGCTGCAGTGCGGAGGGCTGTTCCAGC
CGCGCCAAGCACTTCGGACGCTGCTGGAAACATGGTGCGGAGGTGCTTCCATTGCTCTCTTGTCCCCAGTATTCTCAATCCTAAAGCTTGTATTGTACCC
ATGCAGGCGGATCACTAGAGTGCAAGGCTTCTGGCTGCTCGAACCGCGCCAAGTCGCGCGGCTACTGCTGGTCCCACGGCGGCGGCACCAAGTGCAAGAC
AGAAGACTGCGATAAGATCGCCATCTCCAATGGCCTGTGCTGGGCCCACGGAGGAGGTACGAGTTCTAGTCACCTGAGTCTTTTGCGTAATGCTTGACTG
ACTGAGGTGATCCTTCCCGCAGGCAAGCGCTGCATCGTGCCCGGATGCCGGAAGCAGGCGTACGAGCGGACCTGGAACTACTGCAACAGCCACTTCCAGC
AGTACCAGAAGACGGCGCTCGAGTTGGCCAGGCACAACCACGGAGCATGAAGCATGGATGGATTCAGTGTAGCTATTTATTCGGCACGTCCTACGCCAAG
TGCTACGCGCATCTTCCACTTCGACTTCGCCAGGATCACCATGCGGGAGCTGAAGCTCGGACGAGGTGATTACCGCTCATAGAGATTCACCGAAAAGGAG
GCGCGTTGCGTAGAGGAGGGAGGGAAAGCCTGGAAAAGGCGTGCAAACGAGTAAATGTTAGTCGAGTGAGTTCTGCGAAATACAAGTTCATGTGCATCGT
CATTTTCCGTCGCCGCTTCGCCATGATTGTTGACTTGGATGGTGTTAATGCACTTATGATCATTTCCGGACAACACGGACTCGATCGTCAAGTCAAGATG
ATGTCTTTACCTGGGAATGAGCCCGGGATGGTGCGGCCTAAAGATCGAGAACGGGTAGGAAACTGGAGCCGATGGGCTTTGTGCTCGTTTAACGACGCGG
GACTGGTGGAGCTCGCAGTATTGCCTGGAGAGAGCGGGAGGCAACGCAAGCGCATGCCGCCGCAAACAAACGAAGCGAAACACGGACGTATGGATACCGT
ACCCACTGCAATGACAGACTATCGCGACCCCTTTTTGCTTGCAGTTTGTTGTCAACCACCTCACACGGTGGCCCTAATCAAAACTGTTTCCCGGTTTTGG
CGATCCACGTACCGATGCAGTCGGTGCATACGGAAGTCTATAAGGTGTCCACTGGTTAATACATGTACTTGAGGGCGAGGAGCTTTGTACTTGAAGGTGA
CGTAGGTGTCCAGCCTGCTGTCTTTCGAGCCATGACGTTCTCATCGTCTGTTACTCGGGAGCACCACACGAGCTCGCGGATCTAGATGACAAGCTGTATC
ACCCACCCCCGCTGGCTGCTGTAGCAGCAGTAGGGGTAGGGAAGTCCAGGCTGTATCCTTGGTAGTCTGGCAAACTTGCTCTAATTGGCAACAACACAGC
AGCGACGCTCCAGCAACCCAGGTCGACCAAAAAACGCAACGTCATCTTTGACGTGCTAGTGCCACGCACTTGGTGTACCACAACTGTACCATCTCATTTC
CAGCTAATGTAATGTAATGTATTACGTTTTCGCGTTGCCACACTATGCTGTCGCTAGGCTCAGCTTTGCTAGTCGACGGCATAAGGTGGTGTCCGCATAC
GTCGGGCCCTTCTTCGCCGGCAGTGCGGCGACAATTGCCCTCTCGAGGGCTTTCCGTTTAGGTTTCTCTTGTGCAAGCAGCCGAAGTTGGTCCAGGTCTC
GGCGGGTCTCGAGGCGATAGGCGTATCCGCTCGAGATAAGGTCCGCATCGAGCACAGTCGGTAGTGTCGTGCGTGGGCGTCCACGCCAGGTTCCCTTGGA
CGACGAGTCGAAGTAGGCGGCCATCTGGGTGTACGCTGGGATCTCGGGCCGGCGCAGGATGTGGCCGAACAGACGCCATCGTGCTGCTGTGATTCTGTGG
CGGAGCGGGCGTTCCTGACAGATTTCGTAGAGCGTGGCGTTAGAGATTCGCTGAGGGTAGCGAATGTTTAGTACGCTACGTAGTTGTCGGCGGTGGAAGC
TTTCGAGTCTGCTCAGCTCGGACGGCGTCAGTGCCCACGTTCCGCTGTTGTACAGCAGAACAGGAAGCACATAGCAGTTATACAGCCGGACTCTGGTGGC
GTCACTGACGTACTGGGGCCGGATCCATATTGTCCAGAGCCGACGTAGCGCGCCTGCTGCGAGTATTTTGCGTCGTGTCAGATCTTCTGAGTCGCCGAGT
AGACTGCCAAGCTTCTGTGTGGAGCGCCACGCCTCTTCTGTCGTCCGAGCGTGTCGGGAGTAGCCCGACGAGCCTGTACATCGCTGAATCATGGTTAGTT
ATGTCTTAGTTGCATTCATCTGGAGGGACCAGCGTGCGAACACTGCTGGTGCTTCGGCTTGGATGCGCTGGACCAGCTCGGTATCGCGGCAGACAAAGTC
TGCATCATCAGCATAGACGATCATTTGGTCGAGTAGGGTCCGATTCACTCCGAGGTGGGATGCGAGGTCGCGTAACGCAGCTTCCAGGTAGATGACGAAC
AGGACCGGTGAAAGCGCATCGTCCTGCGGCGTTCCGATGTTGCTATCGAAGCTGTGTTGTGCCTTGGACCCGGAGCGCAGAGAGAGCTTGGTGTCGGCGA
GCAAAACCTTGATCAATCGGACCTCGTCGTCGTGTAAGAATGTCTGGAGTACTTCTACAAGCTTTACGGGGTCGATTGTGTCGAACGCGCGCGAGAGGTC
GATGCCGAGGACATGTATGGTTTTACGATAGCGTTGCACGCGGGCACAGAGCCATTTGTGCGCCCACACGGCGTCAGCAGTGCTTCTGTGTTTGCGGAAT
CCGCTTTGATTGGGGGACAGGAATGTGTCCACCGCAGCGGATATCCGTGCGAGTACGACGAGAGATAAGGCCTTGCGAATGCTGCTTAACAGCACGATGG
GGCGGAGACTGGAACATTCCCCTCGGGGCTTGTTGGGCTTGGGCAGGCACACGAGTGTTCCTTCACCGAGTGCAAGGGGGGTGCCTTGCTCGAAGCTGCA
GTTGACGAGGTCTGCGAAGAGAGGCGCGAGGACTGAAACCCCGTACTTAAGAAGTTCTGCTGGGAGCTCATCTGGCCCAGCGGCGCGTCCGTTGTTGAGG
CGCCGAAAGGCTGCTTCGACTTCTGTTGCTGTAACAGGACGGGTTAGAGATCGCGGTTCACGATCCGGAACAGGATGTGGCCGCCCCGAGTCATAAAACA
GCGTTCGGAAGTGATCTGTGATCACCTTGTTAGTAGTTTGTTACCGCAGGATAGATATACTTACCTTCTTGGTCGTGGAGTAACAGCGGTTGGGGTCGAT
GGGGGCTAATGTCTCGAACTGCTGCATACATTCGTGCCGAGTCGCTCAGATTTTCGATGCGTGTAATCCGCTCGTCCCGTTTGCGAGATGCGATGGCTCG
GCATCGCGCTCGGATTTGATGGAGGATCTTGTTGCGGGCGGCTCGGAGCTCGATCGTGTTAGCGGCGCAGTCGTTGTAGATTCGAAGCTGAAGCGCCCGC
TGGGCCTCAGAGAGCAGCTGAAGTTCATCGTCGTGATGTCGTACGTGGCGGTGGTTAGGACCTGCGAATCCTATAGTCCCCTCGGCTGCTTCTCGGATTC
GATCGAGCGTGTCTGTCCAGCACTGGAGAACGGTGCTGCCTTGTGCTGTTGGCTGTGAAAGCGCTGCCTGGAGCGCGTTCGTGTAGTCGTCTCGTGCTGT
GTCGTCGTAGATGAGATGATCTCGTGCTAACTTGAGTGCTGGATCTGGCTTGA